Previous Contig 007386:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF037A17Sequence521007386 (4)gb:AP005572_18542691e-22Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC clone:OJ15707013328 (4)gb:AY139984_15824262e-15Arabidopsis thaliana expressed protein (At2g46550) mRNA, complete cds.>gb:BT0021
JMSF024G16Sequence677007386 (4)gb:AP005572_18542695e-25Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC clone:OJ15775013328 (4)gb:AY139984_15824263e-16Arabidopsis thaliana expressed protein (At2g46550) mRNA, complete cds.>gb:BT0021
JMSF041B12Sequence563007386 (4)gb:AP005572_18542694e-25Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC clone:OJ15625013328 (4)gb:AY139984_15824260.003Arabidopsis thaliana expressed protein (At2g46550) mRNA, complete cds.>gb:BT0021
JMSF052O03Sequence640007386 (4)gb:AP005572_18542695e-25Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC clone:OJ15939013328 (4)gb:AY087324_15723561e-16Arabidopsis thaliana clone 34178 mRNA, complete sequence.

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF024G16+ AAGCTCGCTGGCCGGTTTAGAG
                      ____________________________________________________________
consensus AAGCTCGCTGGCCGGTTTAGAG
 
. : . : . : . : . : . :
JMSF024G16+ ACGGGGCAATCAAATGATTCTGTCATTCTAAAACCGGTGGGATTCTTGATGCTCTCGAGT
                      ____________________________________________________________
consensus ACGGGGCAATCAAATGATTCTGTCATTCTAAAACCGGTGGGATTCTTGATGCTCTCGAGT
 
. : . : . : . : . : . :
JMSF024G16+ CTAAGACAATCATCTAGGGAATCACTACCAAATGCAGTGTCGAGTTTTTTGTCTCCTATT
JMSF052O03+ CTAGGGAATCACTACCAAATGCAGTGTCGAGTTTTTTGTCTCCTATT
                      ____________________________________________________________
consensus CTAAGACAATCATCTAGGGAATCACTACCAAATGCAGTGTCGAGTTTTTTGTCTCCTATT
 
. : . : . : . : . : . :
JMFF037A17+ CCGAGGTCGTTTTTAACACTAGCCGACATTTTAACCTGAGAATCGAGTAAAGATTTGTCC
JMSF024G16+ CCGAGGTCGTTTTTAACACTAGCCGACATTTTAACCTGAGAATCGAGTAAAGATTTGTCC
JMSF052O03+ CCGAGGTCGTTTTTAACACTAGCCGACATTTTAACCTGAGAATCGAGTAAAGATTTGTCC
JMSF041B12+ TGAGAATCGAGTAAAGATTTGTCC
                      ____________________________________________________________
consensus CCGAGGTCGTTTTTAACACTAGCCGACATTTTAACCTGAGAATCGAGTAAAGATTTGTCC
 
. : . : . : . : . : . :
JMFF037A17+ ACCGTAAACTCGTCAACATATTCAATCTCATATTCACTAAGCTTGGAGGTTGAATTTCCA
JMSF024G16+ ACCGTAAACTCGTCAACATATTCAATCTCATATTCACTAAGCTTGGAGGTTGAATTTCCA
JMSF052O03+ ACCGTAAACTCGTCAACATATTCAATCTCATATTCACTAAGCTTGGAGGTTGAATTTCCA
JMSF041B12+ ACCGTAAACTCGTCAACATATTCAATCTCATATTCACTAAGCTTGGAGGTTGAATTTCCA
                      ____________________________________________________________
consensus ACCGTAAACTCGTCAACATATTCAATCTCATATTCACTAAGCTTGGAGGTTGAATTTCCA
 
. : . : . : . : . : . :
JMFF037A17+ AAGGTCGAAGAACCTTGCATCTCGTCTACCGAAAGGAGGTGTTCACCAGCTAAACCCCCT
JMSF024G16+ AAGGTCGAAGAACCTTGCATCTCGTCTACCGAAAGGAGGTGTTCACCAGCTAAACCCCCT
JMSF052O03+ AAGGTCGAAGAACCTTGCATCTCGTCTACCGAAAGGAGGTGTTCACCAGCTAAACCCCCT
JMSF041B12+ AAGGTCGAAGAACCTTGCATCTCGTCTACCGAAAGGAGGTGTTCACCAGCTAAACCCCCT
                      ____________________________________________________________
consensus AAGGTCGAAGAACCTTGCATCTCGTCTACCGAAAGGAGGTGTTCACCAGCTAAACCCCCT
 
. : . : . : . : . : . :
JMFF037A17+ TGATATCCATAATTGGGTTTAAGATGTAGCCACCATCTCGAGTTAGGAGATAGATTTGAA
JMSF024G16+ TGATATCCATAATTGGGTTTAAGATGTAGCCACCATCTCGAGTTAGGAGATAGATTTGAA
JMSF052O03+ TGATATCCATAATTGGGTTTAAGATGTAGCCACCATCTCGAGTTAGGAGATAGATTTGAA
JMSF041B12+ TGATATCCATAATTGGGTTTAAGATGTAGCCACCATCTCGAGTTAGGAGATAGATTTGAA
                      ____________________________________________________________
consensus TGATATCCATAATTGGGTTTAAGATGTAGCCACCATCTCGAGTTAGGAGATAGATTTGAA
 
. : . : . : . : . : . :
JMFF037A17+ TACGAAGAGTTCCAATTAGAAGGGAGGAAACACGCTCTCTCAGCATCTTGCGGATTGGCA
JMSF024G16+ TACGAAGAGTTCCAATTAGAAGGGAGGAAACACGCTCTCTCAGCATCTTGCGGATTGGCA
JMSF052O03+ TACGAAGAGTTCCAATTAGAAGGGAGGAAACACGCTCTCTCAGCATCTTGCGGATTGGCA
JMSF041B12+ TACGAAGAGTTCCAATTAGAAGGGAGGAAACACGCTCTCTCAGCATCTTGCGGATTGGCA
                      ____________________________________________________________
consensus TACGAAGAGTTCCAATTAGAAGGGAGGAAACACGCTCTCTCAGCATCTTGCGGATTGGCA
 
. : . : . : . : . : . :
JMFF037A17+ GCAGATGCGGGTCCCGTATCTACTTCTTTCGCCGAGGGTGATGTTGGCGGACAACAAGCC
JMSF024G16+ GCAGATGCGGGTCCCGTATCTACTTCTTTCGCCGAGGGTGATGTTGGCGGACAACAAGCC
JMSF052O03+ GCAGATGCGGGTCCCGTATCTACTTCTTTCGCCGAGGGTGATGTTGGCGGACAACAAGCC
JMSF041B12+ GCAGATGCGGGTCCCGTATCTACTTCTTTCGCCGAGGGTGATGTTGGCGGACAACAAGCC
                      ____________________________________________________________
consensus GCAGATGCGGGTCCCGTATCTACTTCTTTCGCCGAGGGTGATGTTGGCGGACAACAAGCC
 
. : . : . : . : . : . :
JMFF037A17+ AACTTCGGGGCTCCTTTTGGCATCTTCCTGGACAAAGCATCGGTTAGCTGTTCTCTGCCA
JMSF024G16+ AACTTCGGGGCT-CTTTTGGCATCTTCCTGGACAAAGCATCGGTTAGCTGTTCTCTGCCA
JMSF052O03+ AACTTCGGGGCT-CTTTTGGCATCTTCCTGGACAAAGCATCGGTTAGCTGTTCTCTGCCA
JMSF041B12+ AACTTCGGGGCT-CTTTTGGCATCTTCCTGGACAAAGCATCGGTTAGCTGTTCTCTGCCA
                      ____________________________________________________________
consensus AACTTCGGGGCT-CTTTTGGCATCTTCCTGGACAAAGCATCGGTTAGCTGTTCTCTGCCA
 
. : . : . : . : . : . :
JMFF037A17+ AGCAGCCCTTGCTTCAGCCACTGCCATTATTCGCCCGTTCTTCTGCACATTTCACT
JMSF024G16+ AGCAGCCCTTGCTTCAGCCACTGCCATTATTCGCCCGTTCTTCTGCACATTTCACT
JMSF052O03+ AGCAGCCCTTGCTTCAGCCACTGCCATTATTCGCCCGTTCTTCTGCACATTTCACTGAAA
JMSF041B12+ GGCAGCCCTTGCTTCAGCCACTGCCATTATTCGCCCGTTCTTCTGCACATTTCACTGAAA
                      ____________________________________________________________
consensus AGCAGCCCTTGCTTCAGCCACTGCCATTATTCGCCCGTTCTTCTGCACATTTCACTGAAA
 
. : . : . : . : . : . :
JMSF052O03+ GAGTGTAAACCAAGAAAGAATTGTTGGAGTCTGAAAGAGAGAGAAAGAGAGAGATGGGTA
JMSF041B12+ GAGTGTAAACCAAGAAAGAATTGTTGGAGTCTGAAAGAGAGAGAAAGAGAGAGATGGGTA
                      ____________________________________________________________
consensus GAGTGTAAACCAAGAAAGAATTGTTGGAGTCTGAAAGAGAGAGAAAGAGAGAGATGGGTA
 
. : . : . : . : . : . :
JMSF052O03+ GTCTTTGGGTTCAAAAAGACAAGATTTTTGCTCATCTTTTTAATTTCATTTTC
JMSF041B12+ GTCTTTGGGTTCAAAAAGACAAGATTTTTGCTCATCTTTTTAATTTCATTTTCATTTTCC
                      ____________________________________________________________
consensus GTCTTTGGGTTCAAAAAGACAAGATTTTTGCTCATCTTTTTAATTTCATTTTCATTTTCC