Previous Contig 007375:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFN006D20Sequence625007375 (3)gb:OSJN00204_1696668e-105Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBb0039L24, complete seque
JMSF040O15Sequence637007375 (3)gb:AY080837_15685302e-41Arabidopsis thaliana putative RNA helicase (At4g00660) mRNA, complete cds.>gb:AY735013316 (2)gb:AY080837_15685307e-59Arabidopsis thaliana putative RNA helicase (At4g00660) mRNA, complete cds.>gb:AY
JMSF044L24Sequence748007375 (3)gb:OSJN00204_16966681e-87Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBb0039L24, complete seque703013316 (2)gb:AY080837_15685302e-50Arabidopsis thaliana putative RNA helicase (At4g00660) mRNA, complete cds.>gb:AY

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN006D20+ GCTGAAAACATCAAAATTTGACGATTGCAGGNCAAAAACCGTATTAA
                      ____________________________________________________________
consensus GCTGAAAACATCAAAATTTGACGATTGCAGGNCAAAAACCGTATTAA
 
. : . : . : . : . : . :
JMFN006D20+ TTGCCCTATAGATGGTTGGAACTCTGGTGATAGAAGCTTGTCAGCCTCGTCCATAACAAG
                      ____________________________________________________________
consensus TTGCCCTATAGATGGTTGGAACTCTGGTGATAGAAGCTTGTCAGCCTCGTCCATAACAAG
 
. : . : . : . : . : . :
JMFN006D20+ CATTGAACAATCTTTTAAAATGCAAACTCCTTTTCTTACAAGGTCTAGTATTCTTCCGGG
                      ____________________________________________________________
consensus CATTGAACAATCTTTTAAAATGCAAACTCCTTTTCTTACAAGGTCTAGTATTCTTCCGGG
 
. : . : . : . : . : . :
JMFN006D20+ GGTTCCCACCAGCAAATGAACTGGTTGATATAGACGCATAATGTCATCTTTTAAGCTAGT
JMSF044L24+ CCCACCAGCAAATGAACTGGTTGATATAGACGCATAATGTCATCTTTTAAGCTAGT
                      ____________________________________________________________
consensus GGTTCCCACCAGCAAATGAACTGGTTGATATAGACGCATAATGTCATCTTTTAAGCTAGT
 
. : . : . : . : . : . :
JMFN006D20+ TCCCCCAGTAGTAACCATGATTTCGATTTGTAAGTGCTTCCCGAGTTCTTTACAAACTTG
JMSF044L24+ TCCCCCAGTAGTAACCATGATTTCGATTTGTAAGTGCTTCCCGAGTTCTTTACAAACTTG
                      ____________________________________________________________
consensus TCCCCCAGTAGTAACCATGATTTCGATTTGTAAGTGCTTCCCGAGTTCTTTACAAACTTG
 
. : . : . : . : . : . :
JMFN006D20+ TGATGTCTGCAGAGCCAATTCTCGAGTTGGGACAAGGATAATACATTGAATAGCATTTTT
JMSF044L24+ TGATGTCTGCAGAGCCAATTCTCGAGTTGGGACAAGGATAATACATTGAATAGCATTTTT
                      ____________________________________________________________
consensus TGATGTCTGCAGAGCCAATTCTCGAGTTGGGACAAGGATAATACATTGAATAGCATTTTT
 
. : . : . : . : . : . :
JMFN006D20+ ATCCTGATCGATTTTTTCCAATGCAGGAATGCAGAAGGCAGCTGTTTTTCCAGTTCCATT
JMSF044L24+ ATCCTGATCGATTTTTTCCAATGCAGGAATGCAGAAGGCAGCTGTTTTTCCAGTTCCATT
                      ____________________________________________________________
consensus ATCCTGATCGATTTTTTCCAATGCAGGAATGCAGAAGGCAGCTGTTTTTCCAGTTCCATT
 
. : . : . : . : . : . :
JMFN006D20+ TTTTGCTCTAGCAAGAATGTCACTTCCGGTTAGGGCAATTGGGATACTCTCCTCCTGGAT
JMSF044L24+ TTTTGCTCTAGCAAGAATGTCACTTCCGGTTAGGGCAATTGGGATACTCTCCTCCTGGAT
JMSF040O15+ TTCCGGTTAGGGCAATTGGGATACTCTCCTCCTGGAT
                      ____________________________________________________________
consensus TTTTGCTCTAGCAAGAATGTCACTTCCGGTTAGGGCAATTGGGATACTCTCCTCCTGGAT
 
. : . : . : . : . : . :
JMFN006D20+ AGGGGATGGTCTCTCAAATCCCTTCTCATATATCCCCATGAGCAGTTCGCGTTTCAGAAA
JMSF044L24+ AGGGGATGGTCTCTCAAATCCCTTCTCATATATCCCCATGAGCAGTTCGCGTTTCAGAAA
JMSF040O15+ AGGGGATGGTCTCTCAAATCCCTTCTCATATATCCCCATGAGCAGTTCGCGTTTCAGAAA
                      ____________________________________________________________
consensus AGGGGATGGTCTCTCAAATCCCTTCTCATATATCCCCATGAGCAGTTCGCGTTTCAGAAA
 
. : . : . : . : . : . :
JMFN006D20+ ATAGTCTTCAAATTCATTCCCCTTAGTAGCTGTCACATCCTCGGTCCTGTAGCGTGTATC
JMSF044L24+ ATAGTCTTCAAATTCATTCCCCTTAGTAGCTGTCACATCCTCGGTCCTGTAGCGTGTATC
JMSF040O15+ ATAGTCTTCAAATTCATTCCCCTTAGTAGCTGTCACATCCTCGGTCCTGTAGCGTGTATC
                      ____________________________________________________________
consensus ATAGTCTTCAAATTCATTCCCCTTAGTAGCTGTCACATCCTCGGTCCTGTAGCGTGTATC
 
. : . : . : . : . : . :
JMFN006D20+ AGGTGGAGATAACTTCAATCGCGCCTTCCAATCTTGCG
JMSF044L24+ AGGTGGAGGTAACTTCAATCGCGCCTTCCAATCTTGCGAACTCGAATCAATGGCTTCAGA
JMSF040O15+ AGGTGGAGGTAACTTCAATCGCGCCTTCCAATCTTGCGAACTCGAATCAATGGCTTCAGA
                      ____________________________________________________________
consensus AGGTGGAGGTAACTTCAATCGCGCCTTCCAATCTTGCGAACTCGAATCAATGGCTTCAGA
 
. : . : . : . : . : . :
JMSF044L24+ CTGTACGGTCTTTTCAACCTCATCAACGGCGGAATCAGCAGTCAACTGGTTGTTCCTTCT
JMSF040O15+ CTGTACGGTCTTTTCAACCTCATCAACGGCGGAATCAGCAGTCAACTGGTTGTTCCTTCT
                      ____________________________________________________________
consensus CTGTACGGTCTTTTCAACCTCATCAACGGCGGAATCAGCAGTCAACTGGTTGTTCCTTCT
 
. : . : . : . : . : . :
JMSF044L24+ GAGCCACTGCTGG
JMSF040O15+ GAGCCACTGCTGGTTCGGTAATGGACTTCTCTGCACGTACTGGTGAGGGTTTCTCGGTTG
                      ____________________________________________________________
consensus GAGCCACTGCTGGTTCGGTAATGGACTTCTCTGCACGTACTGGTGAGGGTTTCTCGGTTG
 
. : . : . : . : . : . :
JMSF040O15+ AAAAGCAGGATTGGCATTAGAGTTCAGGCCGCCATCACCTCGTCCCCCGCCGCCCATCCC
                      ____________________________________________________________
consensus AAAAGCAGGATTGGCATTAGAGTTCAGGCCGCCATCACCTCGTCCCCCGCCGCCCATCCC
 
. : . : . : . : . : . :
JMSF040O15+ CGGCGGCGGATATCTTGCTCTGGAATGCATCGCTAGATTTCACTCCAAAGTCCCCGGGAA
                      ____________________________________________________________
consensus CGGCGGCGGATATCTTGCTCTGGAATGCATCGCTAGATTTCACTCCAAAGTCCCCGGGAA
 
. : . : . : . : . : . :
JMSF040O15+ CCAGAGCTCCAAAAGTCAACGAATTTCAAATAAAGACAAAATCTGCGAATTTCGAATTAT
                      ____________________________________________________________
consensus CCAGAGCTCCAAAAGTCAACGAATTTCAAATAAAGACAAAATCTGCGAATTTCGAATTAT
 
. : . : . : . : . : . :
JMSF040O15+ AGTTTTCCTTTCAGGGAATCTTCGATTGAAAAAATTCAAAGCTTCAGGAAAAAAAATAAA
                      ____________________________________________________________
consensus AGTTTTCCTTTCAGGGAATCTTCGATTGAAAAAATTCAAAGCTTCAGGAAAAAAAATAAA
 
. : . : . : . : . : . :
JMSF040O15+ AATTATACTGATGAAGAAGAATAGAAGACGAATAAACGACCAAGCCTAGGGCGTCGAATC
                      ____________________________________________________________
consensus AATTATACTGATGAAGAAGAATAGAAGACGAATAAACGACCAAGCCTAGGGCGTCGAATC