Previous Contig 007371:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF018B10Sequence553007371 (5)gb:AP003568_18309682e-36Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P001750009142 (3)gb:AP003568_18309682e-48Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P001
JMFF020A06Sequence527007371 (5)gb:AP003568_18309686e-19Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P001682009142 (3)gb:AP003568_18309681e-27Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P001
JMFF031G06Sequence455007371 (5)gb:AP003568_18309681e-10Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P001
JMFS048A12Sequence585007371 (5)gb:AP003568_18309687e-19Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P001
JMSF040M08Sequence661007371 (5)gb:AP003568_18309682e-52Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P001877009142 (3)gb:AP003568_18309682e-45Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P001

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF031G06+ GAAGAAGCAAAGGTAAATTGAATTAAAAAATGTTCGAAATACAAGGTTC
                      ____________________________________________________________
consensus GAAGAAGCAAAGGTAAATTGAATTAAAAAATGTTCGAAATACAAGGTTC
 
. : . : . : . : . : . :
JMFF031G06+ ATGTGTTAAGTATCATGTGCTAAAAATAAAATACATGCAAAAGTATAGTATACCTGATTA
                      ____________________________________________________________
consensus ATGTGTTAAGTATCATGTGCTAAAAATAAAATACATGCAAAAGTATAGTATACCTGATTA
 
. : . : . : . : . : . :
JMFF031G06+ GCATATGTATCAACCACATTTACCCAGGCACCCTCTTAGAGTAAAAGCTCTGCAACCGGA
JMSF040M08+ CATATGTATCAGCCGTATTTACCCGAGCACCCTCTTGGAGTAAAAGTTCTGCAACCTGG
                      ____________________________________________________________
consensus GCATATGTATCAGCCGTATTTACCCGGGCACCCTCTTGGAGTAAAAGTTCTGCAACCTGG
 
. : . : . : . : . : . :
JMFF031G06+ ACTGCACCCCAAACTGCACTCCAGTGTAATGCTGTTTGCCCTGTATGATCTGCAACATTT
JMSF040M08+ ATTGCACCTCGAACTGCACTCCAATGTAATGCTGTTTGTCCTGTATGATCCGCAGCATTG
                      ____________________________________________________________
consensus ATTGCACCTCGAACTGCACTCCAGTGTAATGCTGTTTGTCCTGTATGATCTGCAGCATTT
 
. : . : . : . : . : . :
JMFF031G06+ ACCTCTCCTCCATG
JMFF020A06+ CTCAATTATGTATTGCGCAGCGGCAGAGCGGTTGTTAAGAGCGGCC
JMFF018B10+ CTCAATTATGTATTGCGCAGCGGCAGAGCGGTTGTTAAGAGCGGCC
JMFS048A12+ CTCAATTATGTATTGCGCAGCGGCAGAGCGGTTGTTAAGAGCGGCC
JMSF040M08+ ACATCTCCTCCATGCTCAATTATGTATTGCGCAGCGGCAGAGCGGTTGTTAAGAGCGGCC
                      ____________________________________________________________
consensus ACCTCTCCTCCATGCTCAATTATGTATTGCGCAGCGGCAGAGCGGTTGTTAAGAGCGGCC
 
. : . : . : . : . : . :
JMFF020A06+ CACTGGAGGGCGTAGTAGCCGAGGCCATCGGACTCAGATACTGAGCATCCCTCGCTCTCG
JMFF018B10+ CACTGGAGGGCGTAGTAGCCGAGGCCATCGGACTCAGATACTGAGCATCCCTCGCTCTCG
JMFS048A12+ CACTGGAGGGCGTAGTAGCCGAGGCCATCGGACTCAGATACTGAGCATCCCTCGCTCTCG
JMSF040M08+ CACTGGAGGGCGTAGTAGCCGAGGCCATCGGACTCAGATACTGAGCATCCCTCGCTCTCG
                      ____________________________________________________________
consensus CACTGGAGGGCGTAGTAGCCGAGGCCATCGGACTCAGATACTGAGCATCCCTCGCTCTCG
 
. : . : . : . : . : . :
JMFF020A06+ ACTAATCTCTGTAGCTTCTCCACGTCACCGTACGCCGCCGCCGTGTAAACATCGTTCTTC
JMFF018B10+ ACTAATCTCTGTAGCTTCTCCACGTCACCGTACGCCGCCGCCGTGTAAACATCGTTCTTC
JMFS048A12+ ACTAATCTCTGTAGCTTCTCCACGTCACCGTACGCCGCCGCCGTGTAAACATCGTTCTTC
JMSF040M08+ ACTAATCTCTGTAGCTTCTCCACGTCACCGTACGCCGCCGCCGTGTAAACATCGTTCTTC
                      ____________________________________________________________
consensus ACTAATCTCTGTAGCTTCTCCACGTCACCGTACGCCGCCGCCGTGTAAACATCGTTCTTC
 
. : . : . : . : . : . :
JMFF020A06+ GCGCTCTCATCCTCCGCCGCCTCGGCTGAAGCGGCTCCATCATTCGCTGCCGCCGCCGCC
JMFF018B10+ GCGCTCTCATCCTCCGCCGCCTCGGCTGAAGCGGCTCCATCATTCGCTGCCGCCGCCGCC
JMFS048A12+ GCGCTCTCATCCTCCGCCGCCTCGGCTGAAGCGGCTCCATCATTCGCTGCCGCCGCCGCC
JMSF040M08+ GCGCTCTCATCCTCCGCCGCCTCGGCTGAAGCGGCTCCATCATTCGCTGCCGCCGCCGCC
                      ____________________________________________________________
consensus GCGCTCTCATCCTCCGCCGCCTCGGCTGAAGCGGCTCCATCATTCGCTGCCGCCGCCGCC
 
. : . : . : . : . : . :
JMFF020A06+ GCCGCATTTTCCTGATCTCTGGATTCCACCTCCTCCACGATCTCGATCTCCGACGCCATC
JMFF018B10+ GCCGCATTTTCCTGATCTCTGGATTCCACCTCCTCCACGATCTCGATCTCCGACGCCATC
JMFS048A12+ GCCGCATTTTCCTGATCTCTGGATTCCACCTCCTCCACGATCTCGATCTCCGACGCCATC
JMSF040M08+ GCCGCATTTTCCTGATCTCTGGATTCCACCTCCTCCACGATCTCGATCTCCGACGCCATC
                      ____________________________________________________________
consensus GCCGCATTTTCCTGATCTCTGGATTCCACCTCCTCCACGATCTCGATCTCCGACGCCATC
 
. : . : . : . : . : . :
JMFF020A06+ ACGTAAATAATAAAAGTTAATAGTATTCAGCTTCGAAATTACGTATACAAGCAATTCCGT
JMFF018B10+ ACGTAAATAATAAAAGTTAATAGTATTCAGCTTCGAAATTACGTATACAAGCAATTCCGT
JMFS048A12+ ACGTAAATAATAAAAGTTAATAGTATTCAGCTTCGAAATTACGTATACAAGCAATTCCGT
JMSF040M08+ ACGTAAATAATAAAAGTTAATAGTATTCAGCTTCGAAATTACGTATACAAGCAATTCCGT
                      ____________________________________________________________
consensus ACGTAAATAATAAAAGTTAATAGTATTCAGCTTCGAAATTACGTATACAAGCAATTCCGT
 
. : . : . : . : . : . :
JMFF020A06+ ACACGCGCAGATGCGACGCCTAGAGGTTTTGGTCGGAAGGAGGAGGTGAGGGGACGAGTT
JMFF018B10+ ACACGCGCAGATGCGACGCCTAGAGGTTTTGGTCGGAAGGAGGAGGTGAGGGGACGAGTT
JMFS048A12+ ACACGCGCAGATGCGACGCCTAGAGGTTTTGGTCGGAAGGAGGAGGTGAGGGGACGAGTT
JMSF040M08+ ACACGCGCAGATGCGACGCCTAGAGGTTTTGGTCGGAAGGAGGAGGTGAGGGGACGAGTT
                      ____________________________________________________________
consensus ACACGCGCAGATGCGACGCCTAGAGGTTTTGGTCGGAAGGAGGAGGTGAGGGGACGAGTT
 
. : . : . : . : . : . :
JMFF020A06+ AGGAAGGGGCTTGACTCGGTTACGGGGGGCTATACAGAGAGATGCCCAGAAGCCAACTC
JMFF018B10+ AGGAAGGGGCTTGACTCGGTTACGGGGGGCTATACAGAGAGATGCCCAG
JMFS048A12+ AGGAAGGGGCTTGACTCGGTTACGGGGGGCT
JMSF040M08+ AGGAAGGGGCTTGACTCGGTTACGGGGGGCTATACAGAGAGATGCCCAGAAGCCAACTCC
                      ____________________________________________________________
consensus AGGAAGGGGCTTGACTCGGTTACGGGGGGCTATACAGAGAGATGCCCAGAAGCCAACTCC