Previous Contig 007364:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF006M23Sequence481007364 (9)pir|E85362|E853625e-10hypothetical protein AT4g30960 [imported] - Arabidopsis thaliana>gb:ATCHRIV74_15719010561 (7)gb:AF525402_18083092e-61Glycine max SOS2-like protein kinase mRNA, complete cds.
JMFF017B17Sequence479007364 (9)pir|E85362|E853626e-11hypothetical protein AT4g30960 [imported] - Arabidopsis thaliana>gb:ATCHRIV74_15721010561 (7)gb:AF525402_18083092e-61Glycine max SOS2-like protein kinase mRNA, complete cds.
JMFF034J12Sequence488007364 (9)pir|E85362|E853626e-11hypothetical protein AT4g30960 [imported] - Arabidopsis thaliana>gb:ATCHRIV74_15714010561 (7)gb:AF525402_18083098e-62Glycine max SOS2-like protein kinase mRNA, complete cds.
JMFF039D24Sequence477007364 (9)pir|E85362|E853627e-09hypothetical protein AT4g30960 [imported] - Arabidopsis thaliana>gb:ATCHRIV74_15718010561 (7)gb:AF525402_18083091e-59Glycine max SOS2-like protein kinase mRNA, complete cds.
JMFF041B18Sequence655007364 (9)gb:AF319169_17857565e-30Brassica napus CBL-interacting protein kinase (CIPK) mRNA, complete cds.580010561 (7)gb:AF525402_18083091e-43Glycine max SOS2-like protein kinase mRNA, complete cds.
JMFF042D21Sequence643007364 (9)gb:AF319169_17857563e-23Brassica napus CBL-interacting protein kinase (CIPK) mRNA, complete cds.
JMFF045J22Sequence602007364 (9)pir|E85362|E853621e-21hypothetical protein AT4g30960 [imported] - Arabidopsis thaliana>gb:ATCHRIV74_15591010561 (7)gb:AF525402_18083091e-35Glycine max SOS2-like protein kinase mRNA, complete cds.
JMFF049K05Sequence471007364 (9)pir|E85362|E853628e-10hypothetical protein AT4g30960 [imported] - Arabidopsis thaliana>gb:ATCHRIV74_15
JMSF040L06Sequence662007364 (9)gb:AF319169_17857562e-41Brassica napus CBL-interacting protein kinase (CIPK) mRNA, complete cds.884010561 (7)gb:AF525402_18083091e-94Glycine max SOS2-like protein kinase mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF040L06+ GG
                      ____________________________________________________________
consensus GG
 
. : . : . : . : . : . :
JMFF045J22+ CCA
JMFF042D21+ CGCGGACGAGCTCCATGGCGAAGTAGATCTTCGTTT-GCTCGCCA
JMFF041B18+ GAGCTCGCCGCCGCGGACGAGCTCCATGGCGAAGTAGATCTTCGTTTNGCTCGCCA
JMSF040L06+ CGAAGAGCTCGCCGCCGCGGACGAGCTCCATGGCGAAGTAGATCTTCGTTTTGCTCGCCA
                      ____________________________________________________________
consensus CGAAGAGCTCGCCGCCGCGGACGAGCTCCATGGCGAAGTAGATCTTCGTTTTGCTCGCCA
 
. : . : . : . : . : . :
JMFF045J22+ AAACCTCGTGAAGCTCAACAATATTAGGGTGCTTCACCATCTTCATCACCGAGATCTCCC
JMFF042D21+ AAACCTCGTGAAGCTCAACAATATTAGGGTGCTTCACCATCTTCATCACCGAGATCTCCC
JMFF041B18+ AACCCTCGTGAAGCTCAACAATATTAGGGTGCTTCACCATCTTCATCACCGAGATCTCCC
JMSF040L06+ AAACCTCGTGAAGCTCAACAATATTAGGGTGCTTCACCATCTTCATCACCGAGATCTCCC
                      ____________________________________________________________
consensus AAACCTCGTGAAGCTCAACAATATTAGGGTGCTTCACCATCTTCATCACCGAGATCTCCC
 
. : . : . : . : . : . :
JMFF045J22+ GCTTTATCTGGTCCATCATCCCCACTTTTATCACCTTCTCCTTCCCCACCACCTTCATCG
JMFF042D21+ GCTTTATCTGGTCCATCATCCCCACTTTTATCACCTTCTCCTTCCCCACCACCTTCATCG
JMFF034J12+ CTTCATCG
JMFF041B18+ GCTTTATCTGGTCCATCATCCCCACTTTTATCACCTTCTCCTTCCCCACCACCTTCATCG
JMFF049K05+ ATCG
JMFF017B17+ CTTCATCG
JMFF039D24+ ATCG
JMFF006M23+ CTTCATCG
JMSF040L06+ GCTTTATCTGGTCCATCATCCCCCACTTTATCACCTTCTCCTTCCCCACCACCTTCATCG
                      ____________________________________________________________
consensus GCTTTATCTGGTCCATCATCCCCACTTTTATCACCTTCTCCTTCCCCACCACCTTCATCG
 
. : . : . : . : . : . :
JMFF045J22+ CCACGCATTTCCCGGAATGCAGGTTCCGCGCGTGGTACACCTTCGCGAACGTCCCGTGCC
JMFF042D21+ CCACGCATTTCCCGGAATGCAGGTTCCGCGCGTGGTACACCTTCGCGAACGTCCCGTGCC
JMFF034J12+ CCACGCATTTCCCGGAATGCAGGTTCCGCGCGTGGTACACCTTCGCGAACGTCCCGTGCC
JMFF041B18+ CCACGCATTTCCCGGAATGCAGGTTCCGCGCGTGGTACACCTTCGCGAACGTCCCGTGCC
JMFF049K05+ CCACGCATTTCCCGGAATGCAGGTTCCGCGCGTGGTACACCTTCGCGAACGTCCCGTGCC
JMFF017B17+ CCACGCATTTCCCGGAATGCAGGTTCCGCGCGTGGTACACCTTCGCGAACGTCCCGTGCC
JMFF039D24+ CCACGCATTTCCGGGAATGCAGGTTCCGCGCGTGGTACACCTTCGCGAACGTCCCGTGCC
JMFF006M23+ CCACGCATTTCCGGGAATGCAGGTTCCGCGCGTGGTACACCTTCGCGAACGTCCCGTGCC
JMSF040L06+ CCACGCATTTCCCGGAATGCAGGTTCCGCGCGTGGTACACCTTCGCGAACGTCCCGTGCC
                      ____________________________________________________________
consensus CCACGCATTTCCCGGAATGCAGGTTCCGCGCGTGGTACACCTTCGCGAACGTCCCGTGCC
 
. : . : . : . : . : . :
JMFF045J22+ CTAGCATCCTCCCCAGCTCGTATTTCCCGTGCAGAACGCCGCATTTCTCCTCCGCCGCCG
JMFF042D21+ CTAGCATCCTCCCCAGCTCGTATTTCCCGTGCAGAACGCCGCATTTCTCCTCCGCCGCCG
JMFF034J12+ CTAGCATCCTCCCCAGCTCGTATTTCCCGTGCAGAACGCCGCATTTCTCCTCCGCCGCCG
JMFF041B18+ CTAGCATCCTCCCCAGCTCGTATTTCCCGTGCAGAACGCCGCATTTCTCCTCCGCCGCCG
JMFF049K05+ CTAGCATCCTCCCCAGCTCGTATTTCCCGTGCAGAACGCCGCATTTCTCCTCCGCCGCCG
JMFF017B17+ CTAGCATCCTCCCCAGCTCGTATTTCCCGTGCAGAACGCCGCATTTCTCCTCCGCCGCCG
JMFF039D24+ CTAGCATCCTCCCCAGCTCGTATTTCCCGTGCAGAACGCCGCATTTCTCCTCCGCCGCCG
JMFF006M23+ CTAGCATCCTCCCCAGCTCGTATTTCCCGTGCAGAACGCCGCATTTCTCCTCCGCCGCCG
JMSF040L06+ CTAGCATCCTCCCCAGCTCGTATTTCCCGTGCAGAACGCCGCATTTCTCCTCCGCCGCCG
                      ____________________________________________________________
consensus CTAGCATCCTCCCCAGCTCGTATTTCCCGTGCAGAACGCCGCATTTCTCCTCCGCCGCCG
 
. : . : . : . : . : . :
JMFF045J22+ TCGCCATTCTCCAATCACAAACAATAATATTTCTATTCCGATACTCCCTAAACCTAATTT
JMFF042D21+ TCGCCATTCTCCAATCACAAACAATAATATTTCTATTCCGATACTCCCTAAACCTAATTT
JMFF034J12+ TCGCCATTCTCCAATCACAAACAATAATATTTCTATTCCGATACTCCCTAAACCTAATTT
JMFF041B18+ TCGCCATTCTCCAATCACAAACAATAATATTTCTATTCCGATACTCCCTAAACCTAATTT
JMFF049K05+ TCGCCATTCTCCAATCACAAACAATAATATTTCTATTCCGATACTCCCTAAACCTAATTT
JMFF017B17+ TCGCCATTCTCCAATCACAAACAATAATATTTCTATTCCGATACTCCCTAAACCTAATTT
JMFF039D24+ TCGCCATTCTCCAATCACAAACAATAATATTTCTATTCCGATACTCCCTAAACCTAATTT
JMFF006M23+ TCGCCATTCTCCAATCACAAACAATAATATTTCTATTCCGATACTCCCTAAACCTAATTT
JMSF040L06+ TCGCCATTCTCCAATCACAAACAATAATATTTCTATTCCGATACTCCCTAAACCTAATTT
                      ____________________________________________________________
consensus TCGCCATTCTCCAATCACAAACAATAATATTTCTATTCCGATACTCCCTAAACCTAATTT
 
. : . : . : . : . : . :
JMFF045J22+ CACTGCTTAACTTTCAGAAATAAGTTTACTTTTAGGTGAAAAATAGAAAGGATTATAGAT
JMFF042D21+ CACTGCTTAACTTTCAGAAATAAGTTTACTTTTAGGTGAAAAATAGAAAGGATTATAGAT
JMFF034J12+ CACTGCTTAACTTTCAGAAATAAGTTTACTTTTAGGTGAAAAATAGAAAGGATTATAGAT
JMFF041B18+ CACTGCTTAACTTTCAGAAATAAGTTTACTTTTAGGTGAAAAATAGAAAGGATTATAGAT
JMFF049K05+ CACTGCTTAACTTTCAGAAATAAGTTTACTTTTAGGTGAAAAATAGAAAGGATTATAGAT
JMFF017B17+ CACTGCTTAACTTTCAGAAATAAGTTTACTTTTAGGTGAAAAATAGAAAGGATTATAGAT
JMFF039D24+ CACTGCTTAACTTTCAGAAATAAGTTTACTTTTAGGTGAAAAATAGAAAGGATTATAGAT
JMFF006M23+ CACTGCTTAACTTTCAGAAATAAGTTTACTTTTAGGTGAAAAATAGAAAGGATTATAGAT
JMSF040L06+ CACTGCTTAACTTTCAGAAATAAGTTTACTTTTAGGTGAAAAATAGAAAGGATTATAGAT
                      ____________________________________________________________
consensus CACTGCTTAACTTTCAGAAATAAGTTTACTTTTAGGTGAAAAATAGAAAGGATTATAGAT
 
. : . : . : . : . : . :
JMFF045J22+ TAAGGTATGAAGATCAGATCGGAACTGAAGACGGGAATGGATCACCCGTCTTCGACGTGT
JMFF042D21+ TAAGGTATGAAGATCAGATCGGAACTGAAGACGGGAATGGATCACCCGTCTTCGACGTGT
JMFF034J12+ TAAGGTATGAAGATCAGATCGGAACTGAAGACGGGAATGGATCACCCGTCTTCGACGTGT
JMFF041B18+ TAAGGTATGAAGATCAGATCGGAACTGAAGACGGGAATGGATCACCCGTCTTCGACGTGT
JMFF049K05+ TAAGGTATGAAGATCAGATCGGAACTGAAGACGGGAATGGATCACCCGTCTTCGACGTGT
JMFF017B17+ TAAGGTATGAAGATCAGATCGGAACTGAAGACGGGAATGGATCACCCGTCTTCGACGTGT
JMFF039D24+ TAAGGTATGAAGATCAGATCGGAACTGAAGACGGGAATGGATCACCCGTCTTCGACGTGT
JMFF006M23+ TAAGGTATGAAGATCAGATCGGAACTGAAGACGGGAATGGATCACCCGTCTTCGACGTGT
JMSF040L06+ TAAGGTATGAAGATCAGATCGGAACTGAAGACGGGAATGGATCACCCGTCTTCGACGTGT
                      ____________________________________________________________
consensus TAAGGTATGAAGATCAGATCGGAACTGAAGACGGGAATGGATCACCCGTCTTCGACGTGT
 
. : . : . : . : . : . :
JMFF045J22+ TTCCGGTGACAAGTTCTGCCGCCGGAGTGCGGTGGTTTGTGGCCTCCGCCGCCAACTAGA
JMFF042D21+ TTCCGGTGACAAGTTCTGCCGCCGGAGTGCGGTGGTTTGTGGCCTCCGCCGCCAACTAGA
JMFF034J12+ TTCCGGTGACAAGTTCTGCCGCCGGAGTGCGGTGGTTTGTGGCCTCCGCCGCCAACTAGA
JMFF041B18+ TTCCGGTGACAAGTTCTGCCGCCGGAGTGCGGTGGTTTGTGGCCTCCGCCGCCAACTAGA
JMFF049K05+ TTCCGGTGACAAGTTCTGCCGCCGGAGTGCGGTGGTTTGTGGCCTCCGCCGCCAACTAGA
JMFF017B17+ TTCCGGTGACAAGTTCTGCCGCCGGAGTGCGGTGGTTTGTGGCCTCCGCCGCCAACTAGA
JMFF039D24+ TTCCGGTGACAAGTTCTGCCGCCGGAGTGCGGTGGTTTGTGGCCTCCGCCGCCAACTAGA
JMFF006M23+ TTCCGGTGACAAGTTCTGCCGCCGGAGTGCGGTGGTTTGTGGCCTCCGCCGCCAACTAGA
JMSF040L06+ TTCCGGTGACAAGTTCTGCCGCCGGAGTGCGGTGGTTTGTGGCCTCCGCCGCCAACTAGA
                      ____________________________________________________________
consensus TTCCGGTGACAAGTTCTGCCGCCGGAGTGCGGTGGTTTGTGGCCTCCGCCGCCAACTAGA
 
. : . : . : . : . : . :
JMFF045J22+ AGGGGGTTAGAAAGCGGCGATCTTCTCATCTCTCTGCATTCCCTGGCCGCCGGCGCAAAC
JMFF042D21+ AGGGGGTTAGAAAGCGGCGATCTTCTCATCTCTCTGCATTCCCTGGCCGCCGGCGCAAAC
JMFF034J12+ AGGGGGTTAGAAAGCGGCGATCTTCTCATCTCTCTGCATTCCCTGGCCGCCGGCGCAAAC
JMFF041B18+ AGGGGGTTAGAAAGCGGCGATCTTCTCATCTCTCTGCATTCCCTGGCCGCCGGCGCAAAC
JMFF049K05+ AGGGGGTTAGAAAGCGGCGATCTTCTCATCTCTCTGCATTCCCTGGCCGCCGGCGCAAAC
JMFF017B17+ AGGGGGTTAGAAAGCGGCGATCTTCTCATCTCTCTGCATTCCCTGGCCGCCGGCGCAAAC
JMFF039D24+ AGGGGGTTAGAAAGCGGCGATCTTCTCATCTCTCTGCATTCTCTGGCCGCCGGCGCAAAC
JMFF006M23+ AGGGGGTTAGAAAGCGGCGATCTTCTCATCTCTCTGCATTCTCTGGCCGCCGGCGCAAAC
JMSF040L06+ AGGGGGTTAGAAAGCGGCGATCTTCTCATCTCTCTGCATTCCCTGGCCGCCGGCGCAAAC
                      ____________________________________________________________
consensus AGGGGGTTAGAAAGCGGCGATCTTCTCATCTCTCTGCATTCCCTGGCCGCCGGCGCAAAC
 
. : . : . : . : . : . :
JMFF045J22+ TTCTCCAAACAACACTCAGAAAAGGAAAAAATTATCAAAAAATTTCTTTCTTTCTTTTC
JMFF042D21+ TTCTCCAAACAACACTCAGAAAAGGAAAAAATTATCAAAAAATTTCTTTCTTTCTTTTC
JMFF034J12+ TTCTCCAAACAACACTCAGAAAAGGAAAAAATTATCAAAAAATTTCTTTCTTTCTTTT
JMFF041B18+ TTCTCCAAACAACACTCAGAAAAGGAAAAAATTATCAAAAAATTTCTTTCTTTCTTTTC
JMFF049K05+ TTCTCCAAACAACACTCAGAAAAGGAAAAAATTATCAAAAAATTTCT
JMFF017B17+ TTCTCCAAACAACACTCAGAAAAGGAAAAAATTATCAAAAAATTTCTTTCT
JMFF039D24+ TTCTCCAAACAACACTCAGAAAAGGAAAAAATTATCAAAAAATTTCTTTCTTT
JMFF006M23+ TTCTCCAAACAACACTCAGAAAAGGAAAAAATTATCAAAAAATTTCTTTCTTT
JMSF040L06+ TTCTCCAAACAACACTCAGAAAAGGAAAAAATTATCAAAAAATTTCTTTCTTTCTTTTCC
                      ____________________________________________________________
consensus TTCTCCAAACAACACTCAGAAAAGGAAAAAATTATCAAAAAATTTCTTTCTTTCTTTTCC