Previous Contig 007363:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFN006P18Sequence618007363 (3)gb:AY907015_16321091e-37Petunia x hybrida mitochondrial prohibitin 1 (PHB1) mRNA, complete cds; nuclear
JMSF040K20Sequence640007363 (3)pir|T03843|T038433e-84prohibitin - common tobacco>gb:NTU69154_1691892 Nicotiana tabacum prohibitin mRN802007363 (3)gb:AY907015_16321091e-49Petunia x hybrida mitochondrial prohibitin 1 (PHB1) mRNA, complete cds; nuclear

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF040K20- AGTCTGGGTTCCTAGTAAACTAGCTGCCTAGTTATTATAGATTGTT
                      ____________________________________________________________
consensus AGTCTGGGTTCCTAGTAAACTAGCTGCCTAGTTATTATAGATTGTT
 
. : . : . : . : . : . :
rJMSF040K20- TGCTTATCAAAAGAAGAAAAAAATCGTGTAAATTGTTTGTAATCAAGCAGCACCTTATTG
                      ____________________________________________________________
consensus TGCTTATCAAAAGAAGAAAAAAATCGTGTAAATTGTTTGTAATCAAGCAGCACCTTATTG
 
. : . : . : . : . : . :
JMFN006P18+ TTATCAAAACAAAATAAGCTGTTTGTAAGCAAACACCTAGGTGCTCTC
rJMSF040K20- TAAATTGTTTGCTTATCAAAACAAAATAAGCTGTTTGTAAGCAAACACCTAGGTGCTCTC
                      ____________________________________________________________
consensus TAAATTGTTTGCTTATCAAAACAAAATAAGCTGTTTGTAAGCAAACACCTAGGTGCTCTC
 
. : . : . : . : . : . :
JMFN006P18+ TTTTGCAACTAAAAANAACTAAAGAAAAATAGAATCAAATGAGAAAGCTGCAAAAGAATC
rJMSF040K20- TTTTGCAACTAAAAAAAACTAAAGAAAAATAGAATCAAATGAGAAAGCTGCAAAAGAATC
                      ____________________________________________________________
consensus TTTTGCAACTAAAAAAAACTAAAGAAAAATAGAATCAAATGAGAAAGCTGCAAAAGAATC
 
. : . : . : . : . : . :
JMFN006P18+ ATTCCAAACAGAAAGAATGCACAATGTCCAATCAGTATACCAGCACCAACTGAGAAAGCT
rJMSF040K20- ATTCCAAACAGAAAGAATGCACAATGTCCAATCAGTATACCAGCACCAACTGAGAAAGCT
                      ____________________________________________________________
consensus ATTCCAAACAGAAAGAATGCACAATGTCCAATCAGTATACCAGCACCAACTGAGAAAGCT
 
. : . : . : . : . : . :
JMFN006P18+ ACCTGTTCGCCAGTACAAATCCTGCTTAACGATTTTGGAGACCAAGGAGAAGGTTGTTGC
rJMSF040K20- ACCTGTTCGCCAGTACAAATCCTGCTTAACGATTTTGGAGACCAAGGAGAAGGTTGTTGC
                      ____________________________________________________________
consensus ACCTGTTCGCCAGTACAAATCCTGCTTAACGATTTTGGAGACCAAGGAGAAGGTTGTTGC
 
. : . : . : . : . : . :
JMFN006P18+ CCTTAGGAAGGTACTGAATATTAGGAGTCTTGGCCAAGGTGGATGCGATCTCATTCGAGG
rJMSF040K20- CCTTAGGAAGGTACTGAATATTAGGAGTCTTGGCCAAGGTGGATGCGATCTCCTTCGAGG
                      ____________________________________________________________
consensus CCTTAGGAAGGTACTGAATATTAGGAGTCTTGGCCAAGGTGGATGCGATCTCCTTCGAGG
 
. : . : . : . : . : . :
JMFN006P18+ CCTCGATCCTCCTGAGCTCTATTAAACCCATGCCGGCAGCAGAAGTAGCGTCAGAAATGA
rJMSF040K20- CCTCGATCCTCCTGAGCTCTATTAAACCCATGCCGGCAGCAGAAGTAGCGTCAGAAATGA
                      ____________________________________________________________
consensus CCTCGATCCTCCTGAGCTCTATTAAACCCATGCCGGCAGCAGAAGTAGCGTCAGAAATGA
 
. : . : . : . : . : . :
JMFN006P18+ GTTTAGCAGACTCACTCTCACCTTCAGCTCGAATAATTGCGGCTCTCCGCTCTTGTTCAG
rJMSF040K20- GTTTAGCAGACTCACTCTCACCTTCAGCTCGAATAATTGCGGCTCTCCGCTCTTGTTCAG
                      ____________________________________________________________
consensus GTTTAGCAGACTCACTCTCACCTTCAGCTCGAATAATTGCGGCTCTCCGCTCTTGTTCAG
 
. : . : . : . : . : . :
JMFN006P18+ CCTTCATCACAACAAACTTGGACCGCTCCGCTTCCTGCTGAGCAACCTGCTTTTGTTCAA
rJMSF040K20- CCTTCATCACAACAAACTTGGACCGCTCCGCTTCCTGCTGAGCAACCTGCTTTTGTTCAA
                      ____________________________________________________________
consensus CCTTCATCACAACAAACTTGGACCGCTCCGCTTCCTGCTGAGCAACCTGCTTTTGTTCAA
 
. : . : . : . : . : . :
JMFN006P18+ CGGCTTTGGAGAACTCCGCACCGTAAGACAAATGCGTTATAGCGACATCATCAAGCACAA
rJMSF040K20- CGGCTTTGGAGAACTCCGCACCGTAAGACAAATGCGTTATAGCGACATCATCAAGCACAA
JMSF040K20+ CCGTAAGACAAATGCGTTATAGCGACATCATCAAGCACAA
                      ____________________________________________________________
consensus CGGCTTTGGAGAACTCCGCACCGTAAGACAAATGCGTTATAGCGACATCATCAAGCACAA
 
. : . : . : . : . : . :
JMFN006P18+ TGTCAAAATCCTTAGCTCGGCAAATCAAGCTCTCCCGGACCTGAGCCGACACGTGGGGGC
rJMSF040K20- TGTCAAAATCCTTAGCTCGGCAAATCAAGCTCTCCCGGACCTGAGCCGACACGTGGGGGC
JMSF040K20+ TGTCAAAATCCTTAGCTCGGCAAATCAAGCTCTCCCGGACCTGAGCCGACACGTGGGGGC
                      ____________________________________________________________
consensus TGTCAAAATCCTTAGCTCGGCAAATCAAGCTCTCCCGGACCTGAGCCGACACGTGGGGGC
 
. : . : . : . : . : . :
JMFN006P18+ GCTCCGTCAGTAGCTGATCAGCATTAAACT
rJMSF040K20- GCTCCGTCAGTAGCTGATCAGCATTAAACTGAGCAACCACGGATTTAAGAACCTCGTTGC
JMSF040K20+ GCTCCGTCAGTAGCTGATCAGCATTAAACTGAGCAACCACGGATTTAAGAACCTCGTTGC
                      ____________________________________________________________
consensus GCTCCGTCAGTAGCTGATCAGCATTAAACTGAGCAACCACGGATTTAAGAACCTCGTTGC
 
. : . : . : . : . : . :
rJMSF040K20- CGATCGAGGGAAGCACCTTCTCGTCATACTCTAACC
JMSF040K20+ CGATCGAGGGAAGCACCTTCTCGTCATACTCTAACCCCAATGTTTTGAAAATATTGGGGA
                      ____________________________________________________________
consensus CGATCGAGGGAAGCACCTTCTCGTCATACTCTAACCCCAATGTTTTGAAAATATTGGGGA
 
. : . : . : . : . : . :
JMSF040K20+ GATGGCCGACCTCGGGGCGGGATAGGACCCGGAGGGTCAGATTAACCATCTGCAAATCCT
                      ____________________________________________________________
consensus GATGGCCGACCTCGGGGCGGGATAGGACCCGGAGGGTCAGATTAACCATCTGCAAATCCT
 
. : . : . : . : . : . :
JMSF040K20+ TTGTTCCAGACACGGACGAGAAAGTGTGTGGCCTAGTGCGAATATCAAAGATGAACGGCT
                      ____________________________________________________________
consensus TTGTTCCAGACACGGACGAGAAAGTGTGTGGCCTAGTGCGAATATCAAAGATGAACGGCT
 
. : . : . : . : . : . :
JMSF040K20+ TCTGTAGCCACGGGACCAGAAAGTGCGTCCCCTCGCCTACGGTATGGTCGATCACACCAC
                      ____________________________________________________________
consensus TCTGTAGCCACGGGACCAGAAAGTGCGTCCCCTCGCCTACGGTATGGTCGATCACACCAC
 
. : . : . : . : . : . :
JMSF040K20+ GGAACCGATCAAAAAGCACGGCGCGTTGGCCGCCGTCGACGGTGTACATCGCGGAGTTAA
                      ____________________________________________________________
consensus GGAACCGATCAAAAAGCACGGCGCGTTGGCCGCCGTCGACGGTGTACATCGCGGAGTTAA
 
. : . : . : . : . : . :
JMSF040K20+ GCACCGTCGCGCCAACTCCGAAGCCGAAAGCGGCCCGAGCAATGCTGGTGAGAAATGAAA
                      ____________________________________________________________
consensus GCACCGTCGCGCCAACTCCGAAGCCGAAAGCGGCCCGAGCAATGCTGGTGAGAAATGAAA
 
. : . : . : . : . : . :
JMSF040K20+ CGGCTTGTTGGCTTCCCATGATTGAGAACGAAAGTAGAAATCGGAGATTTAGGTAGGGTT
                      ____________________________________________________________
consensus CGGCTTGTTGGCTTCCCATGATTGAGAACGAAAGTAGAAATCGGAGATTTAGGTAGGGTT
 
. : . : . : . : . : . :
JMSF040K20+ TTAGCTCTGCAACGTCGATGGGGTAAAATGAGGTGTATTTGAACCAAACTGGATTCTTCC
                      ____________________________________________________________
consensus TTAGCTCTGCAACGTCGATGGGGTAAAATGAGGTGTATTTGAACCAAACTGGATTCTTCC