Previous Contig 007362:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF007A11Sequence581007362 (13)gb:AF384037_17941466e-60Zea mays nucleosome/chromatin assembly factor C (nfc102) mRNA, complete cds.785010256 (15)gb:AC005917_15331964e-81Arabidopsis thaliana chromosome 2 clone F3P11 map CIC06E08, complete sequence.
JMFF016M02Sequence623007362 (13)gb:AF384037_17941463e-67Zea mays nucleosome/chromatin assembly factor C (nfc102) mRNA, complete cds.798010256 (15)gb:AC005917_15331968e-72Arabidopsis thaliana chromosome 2 clone F3P11 map CIC06E08, complete sequence.
JMFF024C16Sequence516007362 (13)gb:AF384037_17941461e-43Zea mays nucleosome/chromatin assembly factor C (nfc102) mRNA, complete cds.775010256 (15)gb:AC005917_15331962e-86Arabidopsis thaliana chromosome 2 clone F3P11 map CIC06E08, complete sequence.
JMFF027E02Sequence611007362 (13)gb:AF384037_17941468e-67Zea mays nucleosome/chromatin assembly factor C (nfc102) mRNA, complete cds.749010256 (15)gb:AC005917_15331963e-75Arabidopsis thaliana chromosome 2 clone F3P11 map CIC06E08, complete sequence.
JMFF041N20Sequence658007362 (13)gb:AF384037_17941466e-69Zea mays nucleosome/chromatin assembly factor C (nfc102) mRNA, complete cds.594010256 (15)gb:AF384037_17941462e-49Zea mays nucleosome/chromatin assembly factor C (nfc102) mRNA, complete cds.
JMFF042N08Sequence634007362 (13)gb:AF384037_17941462e-56Zea mays nucleosome/chromatin assembly factor C (nfc102) mRNA, complete cds.582010256 (15)gb:AP002901_18237353e-32Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P045
JMFF042N14Sequence635007362 (13)gb:AF384037_17941463e-61Zea mays nucleosome/chromatin assembly factor C (nfc102) mRNA, complete cds.466010256 (15)gb:AP002901_18237352e-15Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P045
JMFF049C24Sequence641007362 (13)gb:AF384037_17941461e-51Zea mays nucleosome/chromatin assembly factor C (nfc102) mRNA, complete cds.457010256 (15)gb:AC005917_15331961e-24Arabidopsis thaliana chromosome 2 clone F3P11 map CIC06E08, complete sequence.
JMFS028A04Sequence644007362 (13)gb:AF384037_17941462e-73Zea mays nucleosome/chromatin assembly factor C (nfc102) mRNA, complete cds.
JMSF034M20Sequence683007362 (13)gb:AF384037_17941462e-79Zea mays nucleosome/chromatin assembly factor C (nfc102) mRNA, complete cds.
JMSF035G13Sequence707007362 (13)sp|O22607|MSI4_ARATH2e-83WD-40 repeat protein MSI4.>pir|G84577|G84577 probable WD-40 repeat protein, MSI4779010256 (15)gb:AF384037_17941462e-87Zea mays nucleosome/chromatin assembly factor C (nfc102) mRNA, complete cds.
JMSF040K15Sequence617007362 (13)gb:AF384037_17941465e-51Zea mays nucleosome/chromatin assembly factor C (nfc102) mRNA, complete cds.860010256 (15)sp|O22607|MSI4_ARATH1e-81WD-40 repeat protein MSI4.>pir|G84577|G84577 probable WD-40 repeat protein, MSI4
JMSF043M18Sequence749007362 (13)gb:AF384037_17941463e-73Zea mays nucleosome/chromatin assembly factor C (nfc102) mRNA, complete cds.741010256 (15)gb:AC005917_15331961e-76Arabidopsis thaliana chromosome 2 clone F3P11 map CIC06E08, complete sequence.

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF034M20+ TGGGGC
JMSF035G13+ CCAGAGAGCACAAAGGGTTCAGTGGGGC
                      ____________________________________________________________
consensus CCAGAGAGCACAAAGGGTTCAGTGGGGC
 
. : . : . : . : . : . :
JMSF034M20+ ACGTTGCCAATGCAAATTCTGCATTCTCACTATGTCCAATCAATGTCAAATCTGGGCGTG
JMFS028A04+ ATGTCCAATCAATGTCAAATCTGGGCGTG
JMSF035G13+ ACATTGCCAATGCAAATTCTGCATTCTCACTATGTCCAATCAATGTCAAATCTGGGCGTG
JMFF041N20+ CGTG
JMSF043M18+ ATGTCCAATCAATGTCAAATCTGGGCGTG
                      ____________________________________________________________
consensus ACGTTGCCAATGCAAATTCTGCATTCTCACTATGTCCAATCAATGTCAAATCTGGGCGTG
 
. : . : . : . : . : . :
JMSF034M20+ AAGCAACAGCTCCAAGAACAGCATGTCGATTAGGTTGGGCTTCCACATCCCAAATTAGAA
JMFS028A04+ AAGCAACAGCTCCAAGAACAGCATGTCGATTAGGTTGGGCTTCCACATCCCAAATTAGAA
JMSF035G13+ AAGCAACAGCTCCAAGAACAGCATGTCGATTAGGTTGGGCTTCCACATCCCAAATTAGAA
JMFF041N20+ AAGCAACAGCTCCAAGAACAGCATGTCGATTAGGTTGGGCTTCCACATCCCAAATTAGAA
JMFF042N14+ CATCCCAAATTAGAA
JMFF027E02+ CAGCATGTCGATTAGGTTGGGCTTCCACATCCCAAATTAGAA
JMFF007A11+ CCCAAATTAGAA
JMFF016M02+ AACAGCATGTCGATTAGGTTGGGCTTCCACATCCCAAATTAGAA
JMSF043M18+ AAGCAACAGCTCCAAGAACAGCATGTCGATTAGGTTGGGCTTCCACATCCCAAATTAGAA
                      ____________________________________________________________
consensus AAGCAACAGCTCCAAGAACAGCATGTCGATTAGGTTGGGCTTCCACATCCCAAATTAGAA
 
. : . : . : . : . : . :
JMSF034M20+ CTTCAGGACTATCAGTATGGGTTGCCACTATGTTTTTATTTTGAGGA-AGCTCTCTGATT
JMFS028A04+ CTTCAGGACTATCAGTATGGGTTGCCACTATGTTTTTATTTTGAGGA-AGCTCTCTGATT
JMSF035G13+ CTTCAGGACTATCAGTATGGGTTGCCACTATGTTTTTATTTTGAGGA-AGCTCTCTGATT
JMFF041N20+ CTTCAGGACTATCAGTATGGGTTGCCACTATGTTTTTATTTTGAGGA-AGCTCTCTGATT
JMFF042N14+ CTTCAGGACTATCAGTATGGGTTGCCACTATGTTTTTATTTTGAGGA-AGCTCTCTGATT
JMFF049C24+ CTATCAGTATGGGTTGCCACTATGTTTTTA-TTTGAGGA-AGCTCTCTGATT
JMFF027E02+ CTTCAGGACTATCAGTATGGGTTGCCACTATGTTTTTATTTTGAGGA-AGCTCTCTGATT
JMFF007A11+ CTTCAGGACTATCAGTATGGGTTGCCACTATGTTTTTATTTTGAGGA-AGCTCTNTGATT
JMFF016M02+ CTTCAGGACTATCAGTATGGGTTGCCACTATGTTTTTATTTTGAGGA-AGCTCTCTGATT
JMFF042N08+ CTTCAGGACTATCAGTATGGGTTGCCACTATGTTTTTA-TTTGAGGANAGCTCTCTGATT
JMSF043M18+ CTTCAGGACTATCAGTATGGGTTGCCACTATGTTTTTATTTTGAGGA-AGCTCTCTGATT
JMSF040K15+ GAGGA-AGCTCTCTGATT
                      ____________________________________________________________
consensus CTTCAGGACTATCAGTATGGGTTGCCACTATGTTTTTATTTTGAGGA-AGCTCTCTGATT
 
. : . : . : . : . : . :
JMSF034M20+ CTGTTAACCTCCCCTGGGTGTATAATGGTTTTGTACTTCTTGACATAAGGTGAGCGTGAT
JMFS028A04+ CTGTTAACCTCCCCTGGGTGTATAATGGTTTTGTACTTCTTGACATAAGGTGAGCGTGAT
JMSF035G13+ CTGTTAACCTCCCCTGGGTGTATAATGGTTTTGTACTTCTTGACATAAGGTGAGCGTGAT
JMFF041N20+ CTGTTAACCTCCCCTGGGTGTATAATGGTTTTGTACTTCTTGACATAAGGTGAGCGTGAT
JMFF042N14+ CTGTTAACCTCCCCTGGGTGTATAATGGTTTTGTACTTCTTGACATAAGGTGAGCGTGAT
JMFF049C24+ CTGTTAACCTCCCCTGGGTGTATAATGGTTTTGTACTTCTTGACATAAGGTGAGCGTGAT
JMFF027E02+ CTGTTAACCTCCCCTGGGTGTATAATGGTTTTGTACTTCTTGACATAAGGTGAGCGTGAT
JMFF007A11+ CTGTTAACCTCCCCTGGGTGTATAATGGTTTTGTACTTCTTGACATAAGGTGAGCGTGAT
JMFF016M02+ CTGTTAACCTCCCCTGGGTGTATAATGGTTTTGTACTTCTTGACATAAGGTGAGCGTGAT
JMFF024C16+ TATAATGGTTTTGTACTTCTTGACATAAGGTGAGCGTGAT
JMFF042N08+ CTGTTAACCTCCCCTGGGTGTATAATGGTTTTGTACTTCTTGACATAAGGTGAGCGTGAT
JMSF043M18+ CTGTTAACCTCCCCTGGGTGTATAATGGTTTTGTACTTCTTGACATAAGGTGAGCGTGAT
JMSF040K15+ CTGTTAACCTCCCCTGGGTGTATAATGGTTTTGTACTTCTTGACATAAGGTGAGCGTGAT
                      ____________________________________________________________
consensus CTGTTAACCTCCCCTGGGTGTATAATGGTTTTGTACTTCTTGACATAAGGTGAGCGTGAT
 
. : . : . : . : . : . :
JMSF034M20+ TCTTCATTGAAGTGTGATATGTGACTGTCTGCTGCAATCCTGGGTCGAACCACATCACAG
JMFS028A04+ TCTTCATTGAAGTGTGATATGTGACTGTCTGCTGCAATCCTGGGTCGAACCACATCACAG
JMSF035G13+ TCTTCATTGAAGTGTGATATGTGACTGTCTGCTGCAATCCTGGGTCGAACCACATCACAG
JMFF041N20+ TCTTCATTGAAGTGTGATATGTGACTGTCTGCTGCAATCCTGGGTCGAACCACATCACAG
JMFF042N14+ TCTTCATTGAAGTGTGATATGTGACTGTCTGCTGCAATCCTGGGTCGAACCACATCACAG
JMFF049C24+ TCTTCATTGAAGTGTGATATGTGACTGTCTGCTGCAATCCTGGGTCGAACCACATCACAG
JMFF027E02+ TCTTCATTGAAGTGTGATATGTGACTGTCTGCTGCAATCCTGGGTCGAACCACATCACAG
JMFF007A11+ TCTTCATTGAAGTGTGATATGTGACTGTCTGCTGCAATCCTGGGTCGAACCACATCACAG
JMFF016M02+ TCTTCATTGAAGTGTGATATGTGACTGTCTGCTGCAATCCTGGGTCGAACCACATCACAG
JMFF024C16+ TCTTCATTGAAGTGTGATATGTGACTGTCTGCTGCAATCCTGGGTCGAACCACATCACAG
JMFF042N08+ TCTTCATTGAAGTGTGATATGTGACTGTCTGCTGCAATCCTGGGTCGAACCACATCACAG
JMSF043M18+ TCTTCATTGAAGTGTGATATGTGACTGTCTGCTGCAATCCTGGGTCGAACCACATCACAG
JMSF040K15+ TCTTCATTGAAGTGTGATATGTGACTGTCTGCTGCAATCCTGGGTCGAACCACATCACAG
                      ____________________________________________________________
consensus TCTTCATTGAAGTGTGATATGTGACTGTCTGCTGCAATCCTGGGTCGAACCACATCACAG
 
. : . : . : . : . : . :
JMSF034M20+ TTGGCTACAATCAAAGTGTTTGGCACTGATTGATCTGTCTGTTCTGAAAGATAAAGTCGT
JMFS028A04+ TTGGCTACAATCAAAGTGTTTGGCACTGATTGATCTGTCTGTTCTGAAAGATAAAGTCGT
JMSF035G13+ TTGGCTACAATCAAAGTGTTTGGCACTGATTGATCTGTCTGTTCTGAAAGATAAAGTCGT
JMFF041N20+ TTGGCTACAATCAAAGTGTTTGGCACTGATTGATCTGTCTGTTCTGAAAGATAAAGTCGT
JMFF042N14+ TTGGCTACAATCAAAGTGTTTGGCACTGATTGATCTGTCTGTTCTGAAAGATAAAGTCGT
JMFF049C24+ TTGGCTACAATCAAAGTGTTTGGCACTGATTGATCTGTCTGTTCTGAAAGATAAAGTCGT
JMFF027E02+ TTGGCTACAATCAAAGTGTTTGGCACTGATTGATCTGTCTGTTCTGAAAGATAAAGTCGT
JMFF007A11+ TTGGCTACAATCAAAGTGTTTGGCACTGATTGATCTGTCTGTTCTGAAAGATAAAGTCGT
JMFF016M02+ TTGGCTACAATCAAAGTGTTTGGCACTGATTGATCTGTCTGTTCTGAAAGATAAAGTCGT
JMFF024C16+ TTGGCTACAATCAAAGTGTTTGGCACTGATTGATCTGTCTGTTCTGAAAGATAAAGTCGT
JMFF042N08+ TTGGCTACAATCAAAGTGTTTGGCACTGATTGATCTGTCTGTTCTGAAAGATAAAGTCGT
JMSF043M18+ TTGGCTACAATCAAAGTGTTTGGCACTGATTGATCTGTCTGTTCTGAAAGATAAAGTCGT
JMSF040K15+ TTGGCTACAATCAAAGTGTTTGGCACTGATTGATCTGTCTGTTCTGAAAGATAAAGTCGT
                      ____________________________________________________________
consensus TTGGCTACAATCAAAGTGTTTGGCACTGATTGATCTGTCTGTTCTGAAAGATAAAGTCGT
 
. : . : . : . : . : . :
JMSF034M20+ TGGCGGTTTTTGTGACTGTGCTGCTCAACCACAGGACCCCATCGGCAGGACAGTGACGGC
JMFS028A04+ TGGCGGTTTTTGTGACTGTGCTGCTCAACCACAGGACCCCATCGGCAGGACAGTGACGGC
JMSF035G13+ TGGCGGTTTTTGTGACTGTGCTGCTCAACCACAGGACCCCATCGGCAGGACAGTGACGGC
JMFF041N20+ TGGCGGTTTTTGTGACTGTGCTGCTCAACCACAGGACCCCATCGGCAGGACAGTGACGGC
JMFF042N14+ TGGCGGTTTTTGTGACTGTGCTGCTCAACCACAGGACCCCATCGGCAGGACAGTGACGGC
JMFF049C24+ TGGCGGTTTTTGTGACTGTGCTGCTCAACCACAGGACCCCATCGGCAGGACAGTGACGGC
JMFF027E02+ TGGCGGTTTTTGTGACTGTGCTGCTCAACCACAGGACCCCATCGGCAGGACAGTGACGGC
JMFF007A11+ TGGCGGTTTTTGTGACTGTGCTGCTCAACCACAGGACCCCATCGGCAGGACAGTGACGGC
JMFF016M02+ TGGCGGTTTTTGTGACTGTGCTGCTCAACCACAGGACCCCATCGGCAGGACAGTGACGGC
JMFF024C16+ TGGCGGTTTTTGTGACTGTGCTGCTCAACCACAGGACCCCATCGGCAGGACAGTGACGGC
JMFF042N08+ TGGCGGTTTTTGTGACTGTGCTGCTCAACCACAGGACCCCATCGGCAGGACAGTGACGGC
JMSF043M18+ TGGCGGTTTTTGTGACTGTGCTGCTCAACCACAGGACCCCATCGGCAGGACAGTGACGGC
JMSF040K15+ TGGCGGTTTTTGTGACTGTGCTGCTCAACCACAGGACCCCATCGGCAGGACAGTGACGGC
                      ____________________________________________________________
consensus TGGCGGTTTTTGTGACTGTGCTGCTCAACCACAGGACCCCATCGGCAGGACAGTGACGGC
 
. : . : . : . : . : . :
JMSF034M20+ CATACGAGGTTATGATTAGCAAACCAGTCATAGAGGACGGGAACGAGCGACTTCCACTGC
JMFS028A04+ CATACGAGGTTATGATTAGCAAACCAGTCATAGAGGACGGGAACGAGCGACTTCCACTGC
JMSF035G13+ CATACGAGGTTATGATTAGCAAACCAGTCATAGAGGACGGGAACGAGCGACTTCCACTGC
JMFF041N20+ CATACGAGGTTATGATTAGCAAACCAGTCATAGAGGACGGGAACGAGCGACTTCCACTGC
JMFF042N14+ CATACGAGGTTATGATTAGCAAACCAGTCATAGAGGACGGGAACGAGCGACTTCCACTGC
JMFF049C24+ CATACGAGGTTATGATTAGCAAACCAGTCATAGAGGACGGGAACGAGCGACTTCCACTGC
JMFF027E02+ CATACGAGGTTATGATTAGCAAACCAGTCATAGAGGACGGGAACGAGCGACTTCCACTGC
JMFF007A11+ CATACGAGGTTATGATTAGCAAACCAGTCATAGAGGACGGGAACGAGCGACTTCCACTGC
JMFF016M02+ CATACGAGGTTATGATTAGCAAACCAGTCATAGAGGACGGGAACGAGCGACTTCCACTGC
JMFF024C16+ CATACGAGGTTATGATTAGCAAACCAGTCATAGAGGACGGGAACGAGCGACTTCCACTGC
JMFF042N08+ CATACGAGGTTATGATTAGCAAACCAGTCATAGAGGACGGGAACGAGCGACTTCCACTGC
JMSF043M18+ CATACGAGGTTATGATTAGCAAACCAGTCATAGAGGACGGGAACGAGCGACTTCCACTGC
JMSF040K15+ CATACGAGGTTATGATTAGCAAACCAGTCATAGAGGACGGGAACGAGCGACTTCCACTGC
                      ____________________________________________________________
consensus CATACGAGGTTATGATTAGCAAACCAGTCATAGAGGACGGGAACGAGCGACTTCCACTGC
 
. : . : . : . : . : . :
JMSF034M20+ GCGTACTTCTCGTCAGCTGCGGCAGCGGCGGCCTTCTTGTCAGCTCCAGGTCCTCTCATC
JMFS028A04+ GCGTACTTCTCGTCAGCTGCGGCAGCGGCGGCCTTCTTGTCAGCTCCAGGTCCTCTCATC
JMSF035G13+ GCGTACTTCTCGTCAGCTGCGGCAGCGGCGGCCTTCTTGTCAGCTCCAGGTCCTCTCATC
JMFF041N20+ GCGTACTTCTCGTCAGCTGCGGCAGCGGCGGCCTTCTTGTCAGCTCCAGGTCCTCTCATC
JMFF042N14+ GCGTACTTCTCGTCAGCTGCGGCAGCGGCGGCCTTCTTGTCAGCTCCAGGTCCTCTCATC
JMFF049C24+ GCGTACTTCTCGTCAGCTGCGGCAGCGGCGGCCTTCTTGTCAGCTCCAGGTCCTCTCATC
JMFF027E02+ GCGTACTTCTCGTCAGCTGCGGCAGCGGCGGCCTTCTTGTCAGCTCCAGGTCCTCTCATC
JMFF007A11+ GCGTACTTCTCGTCAGCTGCGGCAGCGGCGGCCTTCTTGTCAGCTCCAGGTCCTCTCATC
JMFF016M02+ GCGTACTTCTCGTCAGCTGCGGCAGCGGCGGCCTTCTTGTCAGCTCCAGGTCCTCTCATC
JMFF024C16+ GCGTACTTCTCGTCAGCTGCGGCAGCGGCGGCCTTCTTGTCAGCTCCAGGTCCTCTCATC
JMFF042N08+ GCGTACTTCTCGTCAGCTGCGGCAGCGGCGGCCTTCTTGTCAGCTCCAGGTCCTCTCATC
JMSF043M18+ GCGTACTTCTCGTCAGCTGCGGCAGCGGCGGCCTTCTTGTCAGCTCCAGGTCCTCTCATC
JMSF040K15+ GCGTACTTCTCGTCAGCTGCGGCAGCGGCGGCCTTCTTGTCAGCTCCAGGTCCTCTCATC
                      ____________________________________________________________
consensus GCGTACTTCTCGTCAGCTGCGGCAGCGGCGGCCTTCTTGTCAGCTCCAGGTCCTCTCATC
 
. : . : . : . : . : . :
JMSF034M20+ CTGGGGGTGGCGCCGGCAGCGGAGTGCGGCTGCTCGCGATCTCTGTCCTCCTTGGACTTG
JMFS028A04+ CTGGGGGTGGCGCCGGCAGCGGAGTGCGGCTGCTCGCGATCTCTGTCCTCCTTGGACTTG
JMSF035G13+ CTGGGGGTGGCGCCGGCAGCGGAGTGCGGCTGCTCGCGATCTCTGTCCTCCTTGGACTTG
JMFF041N20+ CTGGGGGTGGCGCCGGCAGCGGAGTGCGGCTGCTCGCGATCTCTGTCCTCCTTCGACTTG
JMFF042N14+ CTGGGGGTGGCGCCGGCAGCGGAGTGCGGCTGCTCGCGATCTCTGTCCTCCTTGGACTTG
JMFF049C24+ CTGGGGGTGGCGCCGGCAGCGGAGTGCGGCTGCTCGCGATCTCTGTCCTCCTTGGACTTG
JMFF027E02+ CTGGGGGTGGCGCCGGCAGCGGAGTGCGGCTGCTCGCGATCTCTGTCCTCCTTGGACTTG
JMFF007A11+ CTGGGGGTGGCGCCGGCAGCGGAGTGCGGCTGCTCGCGATCTCTGTCCTCCTTGGACTTG
JMFF016M02+ CTGGGGGTGGCGCCGGCAGCGGAGTGCGGCTGCTCGCGATCTCTGTCCTCCTTGGACTTG
JMFF024C16+ CTGGGGGTGGCGCCGGCAGCGGAGTGCGGCTGCTCGCGATCTCTGTCCTCCTTCGACTTG
JMFF042N08+ CTGGGGGTGGCGCCGGCAGCGGAGTGCGGCTGCTCGCGATCTCTGTCCTCCTTGGACTTG
JMSF043M18+ CTGGGGGTGGCGCCGGCAGCGGAGTGCGGCTGCTCGCGATCTCTGTCCTCCTTGGACTTG
JMSF040K15+ CTGGGGGTGGCGCCGGCAGCGGAGTGCGGCTGCTCGCGATCTCTGTCCTCCTTGGACTTG
                      ____________________________________________________________
consensus CTGGGGGTGGCGCCGGCAGCGGAGTGCGGCTGCTCGCGATCTCTGTCCTCCTTGGACTTG
 
. : . : . : . : . : . :
JMSF034M20+ GCAGAAGAGCCCTTGGGACGGCCGCGCCTCCTCGGCTGCTGCTGAGGAGTTTCCATGGCG
JMFS028A04+ GCAGAAGAGCCCTTGGGACGGCCGCGCCTCCTCGGCTGCTGCTGAGGAGTTTCCATGGCG
JMSF035G13+ GCAGAAGAGCCCTTGGGACGGCCGCGCCTCCTCGGCTGCTGCTGAGGAGTTTCCATGGCG
JMFF041N20+ GCAGAAGAGCCCTTGGGACGGCCGCGCCTCCTCGGCTGCTGCTGAGGAGTTTCCATGGCG
JMFF042N14+ GCAGAAGAGCCCTTGGGACGGCCGCGCCTCCTCGGCTGCTGCTGAGGAGTTTCCATGGCG
JMFF049C24+ GCAGAAGAGCCCTTGGGACGGCCGCGCCTCCTCGGCTGCTGCTGAGGAGTTTCCATGGCG
JMFF027E02+ GCAGAAGAGCCCTTGGGACGGCCGCGCCTCCTCGGCTGCTGCTGAGGAGTTTCCATGGCG
JMFF007A11+ GCAGAAGAGCCCTTGGGACGGCCGCGCCTCCTCGGCTGCTGCTGAGGAGTTTCCATGGCG
JMFF016M02+ GCAGAAGAGCCCTTGGGACGGCCGCGCCTCCTCGGCTGCTGCTGAGGAGTTTCCATGGCG
JMFF024C16+ GCAGAAGAGCCCTTGGGACGGCCGCGCCTCCTCGGCTGCTGCTGAGGAGTTTCCATGGCG
JMFF042N08+ GCAGAAGAGCCCTTGGGACGGCCGCGCCTCCTCGGCTGCTGCTGAGGAGTTTCCATGGCG
JMSF043M18+ GCAGAAGAGCCCTTGGGACGGCCGCGCCTCCTCGGCTGCTGCTGAGGAGTTTCCATGGCG
JMSF040K15+ GCAGAAGAGCCCTTGGGACGGCCGCGCCTCCTCGGCTGCTGCTGAGGAGTTTCCATGGCG
                      ____________________________________________________________
consensus GCAGAAGAGCCCTTGGGACGGCCGCGCCTCCTCGGCTGCTGCTGAGGAGTTTCCATGGCG
 
. : . : . : . : . : . :
JMSF034M20+ GAGTGAGCTAGCT
JMFS028A04+ GAGTGAGCTAGCTGGA
JMSF035G13+ GAGTGAGCTAGCTGGACCT
JMFF041N20+ GAGTGAGCTAGCTGGACCTGACCTACTTGGAAATGG-GACAGTAGAAGGAAGCAGC
JMFF042N14+ GAGTGAGCTAGCTGGACCTGACCTACTTGGAAATGGTGACAGTAGAAGGAAGCAGCAAAA
JMFF049C24+ GAGTGAGCTAGCTGGACCTGACCTACTTGGAAATGGTGACAGTAGAAGGAAGCAGCAAAA
JMFF027E02+ GAGTGAGCTAGCTGGACCTGACCT
JMFF007A11+ GAGTGAGCTAGCTGGACCTGACCT
JMFF016M02+ GAGTGAGCTAGCTGGACCTGACCTACTTGGAAATGGTGAC
JMFF024C16+ GAGTGAGCTAGCTGGACCTGACCTACTTGGAAATGGTGACAGTAGAAGGAAGCAGC
JMFF042N08+ GAGTGAGCTAGCTGGACCTGACCTACTTGGAAATGGTGACAGTAGAAGGAAGCAGCAAAA
JMSF043M18+ GAGTGAGCTAGCTGGACCTGACCTACTTGGAAATGGTGACAGTAGAAGGAAGCAGCAAAA
JMSF040K15+ GAGTGAGCTAGCTGGACCTGACCTACTTGGAAATGGTGACAGTAGAAGGAAGCAGCAAAA
                      ____________________________________________________________
consensus GAGTGAGCTAGCTGGACCTGACCTACTTGGAAATGGTGACAGTAGAAGGAAGCAGCAAAA
 
. : . : . : . : . : . :
JMFF042N14+ CAGCGGGGGTTTAGATGAAAT
JMFF049C24+ CAGCGGGGGTTTAGATGAAATGACTAGAATAGACTGGGAAGCGACAATGCG
JMFF042N08+ CAGCGGGGGTTTAGATGAAATGACTAGAATAGACT
JMSF043M18+ CAGCGGGGGTTTAGATGAAATGACTAGAATAGACTGGGAAGCGACAATGCGAAAGACACC
JMSF040K15+ CAGCGGGGGTTTAGATGAAATGACTAGAATAGACTGGGAAGCGACAATGCGAAAGACACC
                      ____________________________________________________________
consensus CAGCGGGGGTTTAGATGAAATGACTAGAATAGACTGGGAAGCGACAATGCGAAAGACACC