Previous Contig 007359:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF011O07Sequence500007359 (28)480007359 (28)
JMFF021L16Sequence455007359 (28)407007359 (28)
JMFF026H20Sequence454007359 (28)417007359 (28)
JMFF033D04Sequence466007359 (28)444007359 (28)
JMFF034L17Sequence454007359 (28)409007359 (28)
JMFF038F06Sequence429007359 (28)446007359 (28)
JMFF041J18Sequence447007359 (28)448007359 (28)
JMFF041P17Sequence469007359 (28)469007359 (28)
JMFF044I05Sequence448007359 (28)448007359 (28)
JMFN008F11Sequence443007359 (28)
JMFN039H04Sequence296007359 (28)
JMSF009D16Sequence233007359 (28)395007359 (28)
JMSF010D16Sequence208007359 (28)399007359 (28)
JMSF040J05Sequence489007359 (28)436007359 (28)
JMSF048F15Sequence464007359 (28)415007359 (28)

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF011O07- GATG
JMFF011O07+ TTTTTTTTTTGATAGAGAAATTGATG
JMSF040J05+ TTGATG
                      ____________________________________________________________
consensus TTTTTTTTTTGATAGAGAAATTGATG
 
. : . : . : . : . : . :
rJMFF011O07- AGATTAACACGGNAAATATACTTTAGATAACTGGAGAAATCACTGATTTATTAAACACAG
JMSF048F15+ TAC-TTAGATAACTGGAGAAATCACTGATTTATTAAACACAG
rJMFF041J18- AACTGGAGAAATCACTGATTTATTAAACACAG
JMFF041J18+ ACTGGAGAAATCACTGATTTATTAAACACAG
JMFN008F11+ AC-TTAGATAACTGGAGAAATCACTGATTTATTAAACACAG
rJMFF038F06- AATCACTGATTTATTAAACACAG
JMFF038F06+ TATTAAACACAG
rJMSF048F15- G
JMFF011O07+ AGATTAACACGG-AAATATAC-TTAGATAACTGGAGAAATCACTGATTTATTAAACACAG
rJMFF041P17- AACACGG-AAATATAC-TTAGATAACTGGAGAAATCACTGATTTATTAAACACAG
JMFF041P17+ AACACGG-AAATATAC-TTAGATAACTGGAGAAATCACTGATTTATTAAACACAG
JMFF044I05+ CTGGAGAAATCACTGATTTATTAAACACAG
rJMFF044I05- CTGGAGAAATCACTGATTTATTAAACACAG
JMFF033D04+ TAC-TTAGATAACTGGAGAAATCACTGATTTATTAAACACAG
JMFF034L17+ TGGAGAAATCACTGATTTATTAAACACAG
JMFF026H20+ TGGAGAAATCACTGATTTATTAAACACAG
rJMFF033D04- AATCACTGATTTATTAAACACAG
JMFF021L16+ GGAGAAATCACTGATTTATTAAACACAG
rJMSF040J05- CTGATTTATTAAACACAG
rJMFF026H20- G
JMSF040J05+ AGATTAACACGG-AAATATAC-TTAGATAACTGGAGAAATCACTGATTTATTAAACACAG
                      ____________________________________________________________
consensus AGATTAACACGG-AAATATAC-TTAGATAACTGGAGAAATCACTGATTTATTAAACACAG
 
. : . : . : . : . : . :
rJMFF011O07- CGATTCA-CTGGTGAGTGATCAGTGATCACCG-TTTGTCAACACTCAAC-GTACTATTTA
JMSF048F15+ CGATTCA-CTGGTGAGTGATCAGTGATCACCG-TTTGTCAACACTCAAC-GTACTATTTA
rJMFF041J18- CGATTCA-CTGGTGAGTGATCAGTGATCACCG-TTTGTCAACACTCAAC-GTACTATTTA
JMFF041J18+ CGATTCA-CTGGTGAGTGATCAGTGATCACCG-TTTGTCAACACTCAAC-GTACTATTTA
JMFN008F11+ CGATTCA-CTGGTGAGTGATCAGTGATCACCG-TTTGTCAACACTCAAC-GTACTATTTA
rJMFF038F06- CGATTCA-CTGGTGAGTGATCAGTGATCACCG-TTTGTCAACACTCAAC-GTACTATTTA
JMFF038F06+ CGATTCACCTGGTGAGTGATCAGTGATCACCG-TTTGTCAACACTCAAC-GTACTATTTA
rJMSF048F15- CGATTCA-CTGGTGAGTGATCAGTGATCACCG-TTTGTCAACACTCAAC-GTACTATTTA
rJMSF009D16- GTCAACACTCAAC-GTACTATTTA
JMFF011O07+ CGATTCA-CTGGTGAGTGATCAGTGATCACCG-TTTGTCAACACTCAAC-GTACTATTTA
rJMFF041P17- CGATTCA-CTGGTGAGTGATCAGTGATCACCG-TTTGTCAACACTCAAC-GTACTATTTA
JMFF041P17+ CGATTCA-CTGGTGAGTGATCAGTGATCACCG-TTTGTCAACACTCAAC-GTACTATTTA
JMFF044I05+ CGATTCA-CTGGTGAGTGATCAGTGATCACCG-TTTGTCAACACTCAAC-GTACTATTTA
rJMFF044I05- CGATTCA-CTGGGGAGTGATCAGTGATCACCG-TTTGTCAACACTCAAC-GTACTATTTA
JMFF033D04+ CGATTCA-CTGGTGAGTGATCAGTGATCACCG-TTTGTCAACACTCAAC-GTACTATTTA
JMFF034L17+ CGATTCA-CTGGTGAGTGATCAGTGATCACCG-TTTGTCAACACTCAAC-GTACTATTTA
JMFF026H20+ CGATTCA-CTGGTGAGTGATCAGTGATCACCG-TTTGTCAACACTCAAC-GTACTATTTA
rJMFF033D04- CGATTCA-CTGGTGAGTGATCAGTGATCACCG-TTTGTCAACACTCAAC-GTACTATTTA
rJMFF034L17- CTGGTGAGTGATCAGTGATCACCG-TTTGTCAACACTCAAC-GTACTATTTA
JMFF021L16+ CGATTCA-CTGGTGAGTGATCAGTGATCACCG-TTTGTCAACACTCAAC-GTACTATTTA
rJMSF010D16- ATCAGTGATCACCGNTTTGTCAACACTCAACGGTACTATTTA
rJMSF040J05- CGATTCA-CTGGTGAGTGATCAGTGATCACCGNTTTGTCAACACTCAAC-GTACTATTTA
rJMFF026H20- CGATTCA-CTGGTGAGTGATCAGTGATCACCG-TTTGTCAACACTCAAC-GTACTATTTA
rJMFF021L16- GGTGAGTGATCAGTGATCACCG-TTTGTCAACACTCAAC-GTACTATTTA
JMSF040J05+ CGATTCA-CTGGTGAGTGATCAGTGATCACCG-TTTGTCAACACTCAAC-GTACTATTTA
                      ____________________________________________________________
consensus CGATTCA-CTGGTGAGTGATCAGTGATCACCG-TTTGTCAACACTCAAC-GTACTATTTA
 
. : . : . : . : . : . :
rJMFF011O07- CATCTAGAAACTCCCAATATAAGAGATCAAACACCATTCCTCGGAAACTGGAGCTGATCG
JMSF048F15+ CATCTAGAAACTCCCAATATAAGAGATCAAACACCATTCCTCGGAAACTGGAGCTGATCG
rJMFF041J18- CATCTAGAAACTCCCAATATAAGAGATCAAACACCATTCCTCGGAAACTGGAGCTGATCG
JMFF041J18+ CATCTAGAAACTCCCAATATAAGAGATCAAACACCATTCCTCGGAAACTGGAGCTGATCG
JMFN008F11+ CATCTAGAAACTCCCAATATAAGAGATCAAACACCATTCCTCGGAAACTGGAGCTGATCG
rJMFF038F06- CATCTAGAAACTCCCAATATAAGAGATCAAACACCATTCCTCGGAAACTGGAGCTGATCG
JMFF038F06+ CATCTAGAAACTCCCAATATAAGAGATCAAACACCATTCCTCGGAAACTGGAGCTGATCG
rJMSF048F15- CATCTAGAAACTCCCAATATAAGAGATCAAACACCATTCCTCGGAAACTGGAGCTGATCG
rJMSF009D16- CATCTAGAAACTCCCAATATAAGAGATCAAACACCATTCCTCGGAAACTGGAGCTGATCG
JMFN039H04+ AACTGGAGCTGATCG
JMFF011O07+ CATCTAGAAACTCCCAATATAAGAGATCAAACACCATTCCTCGGAAACTGGAGCTGATCG
rJMFF041P17- CATCTAGAAACTCCCAATATAAGAGATCAAACACCATTCCTCGGAAACTGGAGCTGATCG
JMFF041P17+ CATCTAGAAACTCCCAATATAAGAGATCAAACACCATTCCTCGGAAACTGGAGCTGATCG
JMFF044I05+ CATCTAGAAACTCCCAATATAAGAGATCAAACACCATTCCTCGGAAACTGGAGCTGATCG
rJMFF044I05- CATCTAGAAACTCCCAATATAAGAGATCAAACACCATTCCTCGGAAACTGGAGCTGATCG
JMFF033D04+ CATCTAGAAACTCCCAATATAAGAGATCAAACACCATTCCTCGGAAACTGGAGCTGATCG
JMFF034L17+ CATCTAGAAACTCCCAATATAAGAGATCAAACACCATTCCTCGGAAACTGGAGCTGATCG
JMFF026H20+ CATCTAGAAACTCCCAATATAAGAGATCAAACACCATTCCTCGGAAACTGGAGCTGATCG
rJMFF033D04- CATCTAGAAACTCCCAATATAAGAGATCAAACACCATTCCTCGGAAACTGGAGCTGATCG
rJMFF034L17- CATCTAGAAACTCCCAATATAAGAGATCAAACACCATTCCTCGGAAACTGGAGCTGATCG
JMFF021L16+ CATCTAGAAACTCCCAATATAAGAGATCAAACACCATTCCTCGGAAACTGGAGCTGATCG
rJMSF010D16- CATCTAGAAACTCCCAATATAAGAGATCAAACACCATTCCTCGGAAACTGGAGCTGATCG
rJMSF040J05- CATCTAGAAACTCCCAATATAAGAGATCAAACACCATTCCTCGGAAACTGGAGCTGATCG
rJMFF026H20- CATCTAGAAACTCCCAATATAAGAGATCAAACACCATTCCTCGGAAACTGGAGCTGATCG
rJMFF021L16- CATCTAGAAACTCCCAATATAAGAGATCAAACACCATTCCTCGGAAACTGGAGCTGATCG
JMSF040J05+ CATCTAGAAACTCCCAATATAAGAGATCAAACACCATTCCTCGGAAACTGGAGCTGATCG
                      ____________________________________________________________
consensus CATCTAGAAACTCCCAATATAAGAGATCAAACACCATTCCTCGGAAACTGGAGCTGATCG
 
. : . : . : . : . : . :
rJMFF011O07- GAAAGTTCATTCAGGAATCGGCGACCGGAACGGTCTCTTCTGCTTCTGGATCTTCAAAGT
JMSF048F15+ GAAAGTTCATTCAGGAATCGGCGACCGGAACGGTCTCTTCTGCTTCTGGATCTTCAAAGT
rJMFF041J18- GAAAGTTCATTCAGGAATCGGCGACCGGAACGGTCTCTTCTGCTTCTGGATCTTCAAAGT
JMFF041J18+ GAAAGTTCATTCAGGAATCGGCGACCGGAACGGTCTCTTCTGCTTCTGGATCTTCAAAGT
JMFN008F11+ GAAAGTTCATTCAGGAATCGGCGACCGGAACGGTCTCTTCTGCTTCTGGATCTTCAAAGT
rJMFF038F06- GAAAGTTCATTCAGGAATCGGCGACCGGAACGGTCTCTTCTGCTTCTGGATCTTCAAAGT
JMFF038F06+ GAAAGTTCATTCAGGAATCGGCGACCGGAACGGTCTCTTCTGCTTCTGGATCTTCAAAGT
rJMSF048F15- GAAAGTTCATTCAGGAATCGGCGACCGGAACGGTCTCTTCTGCTTCTGGATCTTCAAAGT
rJMSF009D16- GAAAGTTCATTCAGGAATCGGCGACCGGAACGGTCTCTTCTGCTTCTGGATCTTCAAAGT
JMFN039H04+ GAAAGTTCATTCAGGAATCGGCGACCGGAACGGTCTATTCTGCTTCTGGATCTTCAAAGT
JMFF011O07+ GAAAGTTCATTCAGGAATCGGCGACCGGAACGGTCTCTTCTGCTTCTGGATCTTCAAAGT
rJMFF041P17- GAAAGTTCATTTAGGAATCGGCGACCGGAACGGTCTCTTCTGCTTCTGGATCTTCAAAGT
JMFF041P17+ GAAAGTTCATTTAGGAATCGGCGACCGGAACGGTCTCTTCTGCTTCTGGATCTTCAAAGT
JMFF044I05+ GAAAGTTCATTCAGGAATCGGCGACCGGAACGGTCTCTTCTGCTTCTGGATCTTCAAAGT
rJMFF044I05- GAAAGTTCATTCAGGAATCGGCGACCGGAACGGTCTCTTCTGCTTCTGGATCTTCAAAGT
JMFF033D04+ GAAAGTTCATTCAGGAATCGGCGACCGGAACGGTCTCTTCTGCTTCTGGATCTTCAAAGT
JMFF034L17+ GAAAGTTCATTCAGGAATCGGCGACCGGAACGGTCTCTTCTGCTTCTGGATCTTCAAAGT
JMFF026H20+ GAAAGTTCATTCAGGAATCGGCGACCGGAACGGTCTCTTCTGCTTCTGGATCTTCAAAGT
rJMFF033D04- GAAAGTTCATTCAGGAATCGGCGACCGGAACGGTCTCTTCTGCTTCTGGATCTTCAAAGT
rJMFF034L17- GAAAGTTCATTCAGGAATCGGCGACCGGAACGGTCTCTTCTGCTTCTGGATCTTCAAAGT
JMFF021L16+ GAAAGTTCATTCAGGAATCGGCGACCGGAACGGTCTCTTCTGCTTCTGGATCTTCAAAGT
rJMSF010D16- GAAAGTTCATTCAGGAATCGGCGACCGGAACGGTCTCTTCTGCTTCTGGATCTTCAAAGT
rJMSF040J05- GAAAGTTCATTCAGGAATCGGCGACCGGAACGGTCTCTTCTGCTTCTGGATCTTCAAAGT
rJMFF026H20- GAAAGTTCATTCAGGAATCGGCGACCGGAACGGTCTCTTCTGCTTCTGGATCTTCAAAGT
rJMFF021L16- GAAAGTTCATTCAGGAATCGGCGACCGGAACGGTCTCTTCTGCTTCTGGATCTTCAAAGT
JMSF040J05+ GAAAGTTCATTCAGGAATCGGCGACCGGAACGGTCTCTTCTGCTTCTGGATCTTCAAAGT
                      ____________________________________________________________
consensus GAAAGTTCATTCAGGAATCGGCGACCGGAACGGTCTCTTCTGCTTCTGGATCTTCAAAGT
 
. : . : . : . : . : . :
rJMFF011O07- TGGGGTCATGAGCATCAACCGCTTTCTTCTCAGCCAAACCCATCTCAGCCTGAGAGTAAC
JMSF048F15+ TGGGGTCATGAGCATCAACCGCTTTCTTCTCAGCCAAACCCATCTCAGCCTGAGAGTAAC
rJMFF041J18- TGGGGTCATGAGCATCAACCGCTTTCTTCTCAGCCAAACCCATCTCAGCCTGAGAGTAAC
JMFF041J18+ TGGGGTCATGAGCATCAACCGCTTTCTTCTCAGCCAAACCCATCTCAGCCTGAGAGTAAC
JMFN008F11+ TGGGGTCATGAGCATCAACCGCTTTCTTCTCAGCCAAACCCATCTCAGCCTGAGAGTAAC
rJMFF038F06- TGGGGTCATGAGCATCAACCGCTTTCTTCTCAGCCAAACCCATCTCAGCCTGAGAGTAAC
JMFF038F06+ TGGGGTCATGAGCATCAACCGCTTTCTTCTCAGCCAAACCCATCTCAGCCTGAGAGTAAC
rJMSF048F15- TGGGGTCATGAGCATCAACCGCTTTCTTCTCAGCCAAACCCATCTCAGCCTGAGAGTAAC
rJMSF009D16- TGGGGTCATGAGCATCAACCGCTTTCTTCTCAGCCAAACCCATCTCAGCCTGAGAGTAAC
JMFN039H04+ TGGGGTCATGAGCATCAGCCGCTTTCTTCTCAGCCAAACCCATCTCAACCTGAGAGTAAC
JMFF011O07+ TGGGGTCATGAGCATCAACCGCTTTCTTCTCAGCCAAACCCATCTCAGCCTGAGAGTAAC
rJMFF041P17- TGGGGTCATGAGCATCAACCGCTTTCTTCTCAGCCAAACCCATCTCAGCCTGAGAGTAAC
JMFF041P17+ TGGGGTCATGAGCATCAACCGCTTTCTTCTCAGCCAAACCCATCTCAGCCTGAGAGTAAC
JMFF044I05+ TGGGGTCATGAGCATCAACCGCTTTCTTCTCAGCCAAACCCATCTCAGCCTGAGAGTAAC
rJMFF044I05- TGGGGTCATGAGCATCAACCGCTTTCTTCTCAGCCAAACCCATCTCATCCTGAGAGTAAC
JMFF033D04+ TGGGGTCATGAGCATCAACCGCTTTCTTCTCAGCCAAACCCATCTCAGCCTGAGAGTAAC
JMFF034L17+ TGGGGTCATGAGCATCAACCGCTTTCTTCTCAGCCAAACCCATCTCAGCCTGAGAGTAAC
JMFF026H20+ TGGGGTCATGAGCATCAACCGCTTTCTTCTCAGCCAAACCCATCTCAGCCTGAGAGTAAC
rJMFF033D04- TGGGGTCATGAGCATCAACCGCTTTCTTCTCAGCCAAACCCATCTCAGCCTGAGAGTAAC
rJMFF034L17- TGGGGTCATGAGCATCAACCGCTTTCTTCTCAGCCAAACCCATCTCAGCCTGAGAGTAAC
JMFF021L16+ TGGGGTCATGAGCATCAACCGCTTTCTTCTCAGCCAAACCCATCTCAGCCTGAGAGTAAC
rJMSF010D16- TGGGGTCATGAGCATCAACCGCTTTCTTCTCAGCCAAACCCATCTCAGCCTGAGAGTAAC
rJMSF040J05- TGGGGTCATGAGCATCAACCGCTTTCTTCTCAGCCAAACCCATCTCAGCCTGAGAGTAAC
rJMFF026H20- TGGGGTCATGAGCATCAACCGCTTTCTTCTCAGCCAAACCCATCTCAGCCTGAGAGTAAC
rJMFF021L16- TGGGGTCATGAGCATCAACCGCTTTCTTCTCAGCCAAACCCATCTCAGCCTGAGAGTAAC
JMSF009D16+ GTCATGAGCATCAACCGCTTTCTTTTCAGCCAAACCCATCTCAGCCTGAGAGTAAC
JMSF010D16+ TCAGCCAAACCCATCTCAGCCTGAGAGTAAC
JMSF040J05+ TGGGGTCATGAGCATCAACCGCTTTCTTCTCAGCCAAACCCATCTCAGCCTGAGAGTAAC
                      ____________________________________________________________
consensus TGGGGTCATGAGCATCAACCGCTTTCTTCTCAGCCAAACCCATCTCAGCCTGAGAGTAAC
 
. : . : . : . : . : . :
rJMFF011O07- CGTCACCGGACCACGTGAACTTCCCGCCATGGCCTCCTTTCTTCGGCGATCCACTCATCC
JMSF048F15+ CGTCACCGGACCACGTGAACTTCCCGCCATGGCCTCCTTTCTTCGGCGATCCACTCATCC
rJMFF041J18- CGTCACCGGACCACGTGAACTTCCCGCCATGGCCTCCTTTCTTCGGCGATCCACTCATCC
JMFF041J18+ CGTCACCGGACCACGTGAACTTCCCGCCATGGCCTCCTTTCTTCGGCGATCCACTCATCC
JMFN008F11+ CGTCACCGGACCACGTGAACTTCCCGCCATGGCCTCCTTTCTTCGGCGATCCACTCATCC
rJMFF038F06- CGTCACCGGACCACGTGAACTTCCCGCCATGGCCTCCTTTCTTCGGCGATCCACTCATCC
JMFF038F06+ CGTCACCGGACCACGTGAACTTCCCGCCATGGCCTCCTTTCTTCGGCGATCCACTCATCC
rJMSF048F15- CGTCACCGGACCACGTGAACTTCCCGCCATGGCCTCCTTTCTTCGGCGATCCACTCATCC
rJMSF009D16- CGTCACCGGACCACGTGAACTTCCCGCCATGGCCTCCTTTCTTCGGCGATCCACTCATCC
JMFN039H04+ CGTCACCGGACCACGTGAACTTCCCGCCATGGCCTCCTTTCTTCGGCGATCCACTCATCC
JMFF011O07+ CGTCACCGGACCACGTGAACTTCCCGCCATGGCCTCCTTTCTTCGGCGATCCACTCATCC
rJMFF041P17- CGTCACCGGACCACGTGAACTTCCCGCCATGGCCTCCTTTCTTCGGCGATCCACTCATCC
JMFF041P17+ CGTCACCGGACCACGTGAACTTCCCGCCATGGCCTCCTTTCTTCGGCGATCCACTCATCC
JMFF044I05+ CGTCACCGGACCACGTGAACTTCCCGCCATGGCCTCCTTTCTTCGGCGATCCACTCATCC
rJMFF044I05- CGTCACCGGACCACGTGAACTTCCCGCCATGGCCTCCTTTCTTCGGCGATCCACTCATCC
JMFF033D04+ CGTCACCGGACCACGTGAACTTCCCGCCATGGCCTCCTTTCTTCGGCGATCCACTCATCC
JMFF034L17+ CGTCACCGGACCACGTGAACTTCCCGCCATGGCCTCCTTTCTTCGGCGATCCACTCATCC
JMFF026H20+ CGTCACCGGACCACGTGAACTTCCCGCCATGGCCTCCTTTCTTCGGCGATCCACTCATCC
rJMFF033D04- CGTCACCGGACCACGTGAACTTCCCGCCATGGCCTCCTTTCTTCGGCGATCCACTCATCC
rJMFF034L17- CGTCACCGGACCACGTGAACTTCCCGCCATGGCCTCCTTTCTTCGGCGATCCACTCATCC
JMFF021L16+ CGTCACCGGACCACGTGAACTTCCCGCCATGGCCTCCTTTCTTCGGCGATCCACTCATCC
rJMSF010D16- CGTCACCGGACCACGTGAACTTCCCGCCATGGCCTCCTTTCTTCGGCGATCCACTCATCC
rJMSF040J05- CGTCACCGGACCACGTGAACTTCCCGCCATGGCCTCCTTTCTTCGGCGATCCACTCATCC
rJMFF026H20- CGTCACCGGACCACGTGAACTTCCCGCCATGGCCTCCTTTCTTCGGCGATCCACTCATCC
rJMFF021L16- CGTCACCGGACCACGTGAACTTCCCGCCATGGCCTCCTTTCTTCGGCGATCCACTCATCC
JMSF009D16+ CGTCACCGGACCACGTGAACTTCCCGCCATGGCCTCCTTTCTTCGGCGATCCACTCATCC
JMSF010D16+ CGTCACCGGACCACGTGAACTTCCCGCCATGGCCTCCTTTCTTCGGCGATCCACTCATCC
JMSF040J05+ CGTCACCGGACCACGTGAACTTCCCGCCATGGCCTCCTTTCTTCGGCGATCCACTCATCC
                      ____________________________________________________________
consensus CGTCACCGGACCACGTGAACTTCCCGCCATGGCCTCCTTTCTTCGGCGATCCACTCATCC
 
. : . : . : . : . : . :
rJMFF011O07- CGGTCGCCGATCGCCGGTCCTTCCTGGCGTCCGGCACAGATCTGGCGCTCTTAGTACCTC
JMSF048F15+ CGGTCGCCGATCGCCGGTCCTTCCTGGCGTCCGGCACAGATCTGGCGCTCTTAGTACCTC
rJMFF041J18- CGGTCGCCGATCGCCGGTCCTTCCTGGCGTCCGGCACAGATCTGGCGCTCTTAGTACCTC
JMFF041J18+ CGGTCGCCGATCGCCGGTCCTTCCTGGCGTCCGGCACAGATCTGGCGCTCTTAGTACCTC
JMFN008F11+ CGGTCGCCGATCGCCGGTCCTTCCTGGCGTCCGGCACAGATCTGGCGCTCTTAGTACCTC
rJMFF038F06- CGGTCGCCGATCGCCGGTCCTTCCTGGCGTCCGGCACAGATCTGGCGCTCTTAGTACCTC
JMFF038F06+ CGGTCGCCGATCGCCGGTCCTTCCTGGCGTCCGGCACAGATCTGGCGCTCTTAGTACCTC
rJMSF048F15- CGGTCGCCGATCGCCGGTCCTTCCTGGCGTCCGGCACAGATCTGGCGCTCTTAGTACCTC
rJMSF009D16- CGGTCGCCGATCGCCGGTCCTTCCTGGCGTCCGGCACAGATCTGGCGCTCTTAGTACCTC
JMFN039H04+ CGGTCGCCGATCGCCGGTCCTTCCTGGCGTCCGGCACAGATCTGGCGCTCTTAGTACCTC
JMFF011O07+ CGGTCGCCGATCGCCGGTCCTTCCTGGCGTCCGGCACAGATCTGGCGCTCTTAGTACCTC
rJMFF041P17- CGGTCGCCGATCGCCGGTCCTTCCTGGCGTCCGGCACAGATCTGGCGCTCTTAGTACCTC
JMFF041P17+ CGGTCGCCGATCGCCGGTCCTTCCTGGCGTCCGGCACAGATCTGGCGCTCTTAGTACCTC
JMFF044I05+ CGGTCGCCGATCGCCGGTCCTTCCTGGCGTCCGGCACAGATCTGGCGCTCTTAGTACCTC
rJMFF044I05- CGGTCGCCGATCGCCGGTCCTTCCTGGCGTCCGGCACAGATCTGGCGCTCTTAGTACCTC
JMFF033D04+ CGGTCGCCGATCGCCGGTCCTTCCTGGCGTCCGGCACAGATCTGGCGCTCTTAGTACCTC
JMFF034L17+ CGGTCGCCGATCGCCGGTCCTTCCTGGCGTCCGGCACAGATCTGGCGCTCTTAGTACCTC
JMFF026H20+ CGGTCGCCGATCGCCGGTCCTTCCTGGCGTCCGGCACAGATCTGGCGCTCTTAGTACCTC
rJMFF033D04- CGGTCGCCGATCGCCGGTCCTTCCTGGCGTCCGGCACAGATCTGGCGCTCTTAGTACCTC
rJMFF034L17- CGGTCGCCGATCGCCGGTCCTTCCTGGCGTCCGGCACAGATCTGGCGCTCTTAGTACCTC
JMFF021L16+ CGGTCGCCGATCGCCGGTCCTTCCTGGCGTCCGGCACAGATCTGGCGCTCTTAGTACCTC
rJMSF010D16- CGGTCGCCGATCGCCGGTCCTTCCTGGCGTCCGGCACAGATCTGGCGCTCTTAGTACCTC
rJMSF040J05- CGGTCGCCGATCGCCGGTCCTTCCTGGCGTCCGGCACAGATCTGGCGCTCTTAGTACCTC
rJMFF026H20- CGGTCGCCGATCGCCGGTCCTTCCTGGCGTCCGGCACAGATCTGGCGCTCTTAGTACCTC
rJMFF021L16- CGGTCGCCGATCGCCGGTCCTTCCTGGCGTCCGGCACAGATCTGGCGCTCTTAGTACCTC
JMSF009D16+ CGGTCGCCGATCGCCGGTCCTTCCTGGCGTCCGGCACAGATCTGGCGCTCTTAGTACCTC
JMSF010D16+ CGGTCGCCGATCGCCGGTCCTTCCTGGCGTCCGGCACAGATCTGGCGCTCTTAGTACCTC
JMSF040J05+ CGGTCGCCGATCGCCGGTCCTTCCTGGCGTCCGGCACAGATCTGGCGCTCTTAGTACCTC
                      ____________________________________________________________
consensus CGGTCGCCGATCGCCGGTCCTTCCTGGCGTCCGGCACAGATCTGGCGCTCTTAGTACCTC
 
. : . : . : . : . : . :
rJMFF011O07- CCTTCCCGGCGTTCTTCATCTTCTTAGTGAGTGAGTGAGGAGTTAGGACAGACGATAAA
JMSF048F15+ CCTTCCCGGCGTTCTTCATCTTCTTAGTGAGTGAGTGAGGAGTTAGGACAGACG
rJMFF041J18- CCTTCCCGGCGTTCTTCATCTTCTTAGTGAGTGAGTGAGGAGTTAGGACAGACGA
JMFF041J18+ CCTTCCCGGCGTTCTTCATCTTCTTAGTGAGTGAGTGAGGAGTTAGGACAGACGA
JMFN008F11+ CCTTCCCGGCGTTCTTCATCTTCTTAGTGAGTGAGTGAGGAGTTAG
rJMFF038F06- CCTTCCCGGCGTTCTTCATCTTCTTAGTGAGTGAGTGAGGAGTTAGGACAGACGATAAA
JMFF038F06+ CCTTCCCGGCGTTCTTCATCTTCTTAGTGAGTGAGTGAGGAGTTAGGACAGACGATAAA
rJMSF048F15- CCTTCCCGGCGTTCTTCATCTTCTTAGTGAGTGAGTGAGGAGTTAGGACAGACG
rJMSF009D16- CCTTCCCGGCGTTCTTCATCTTCTTAGTGAGTGAGTGAGGAGTTAGGACAGACGATC
JMFN039H04+ CCTTCCCGGCGTTCTTCATCTTCTTAGTGAGTGAGTGAGGA
JMFF011O07+ CCTTCCCGGCGTTCTTCATCTTCTTAGTGAGTGAGTGAGGAGTTAGGACAGACGATAAA
rJMFF041P17- CCTTCCCGGCGTTCTTCATCTTCTTAGTGAGTGAGTGAGGAGTTAGGACAGACGATAAC
JMFF041P17+ CCTTCCCGGCGTTCTTCATCTTCTTAGTGAGTGAGTGAGGAGTTAGGACAGACGATAAC
JMFF044I05+ CCTTCCCGGCGTTCTTCATCTTCTTAGTGAGTGAGTGAGGAGTTAGGACAGACGATAAC
rJMFF044I05- CCTTCCCGGCGTTCTTCATCTTCTTAGTGAGTGAGTGAGGAGTTAGGACAGACTATAAC
JMFF033D04+ CCTTCCCGGCGTTCTTCATCTTCTTAGTGAGTGAGTGAGGAGTTAGGACAGACGATAAC
JMFF034L17+ CCTTCCCGGCGTTCTTCATCTTCTTAGTGAGTGAGTGAGGAGTTAGGACAGACGATAAC
JMFF026H20+ CCTTCCCGGCGTTCTTCATCTTCTTAGTGAGTGAGTGAGGAGTTAGGACAGACGATAAC
rJMFF033D04- CCTTCCCGGCGTTCTTCATCTTCTTAGTGAGTGAGTGAGGAGTTAGGACAGACGATAAC
rJMFF034L17- CCTTCCCGGCGTTCTTCATCTTCTTAGTGAGTGAGTGAGGAGTTAGGACAGACGATAAC
JMFF021L16+ CCTTCCCGGCGTTCTTCATCTTCTTAGTGAGTGAGTGAGGAGTTAGGACAGACGATAAC
rJMSF010D16- CCTTCCCGGCGTTCTTCATCTTCTTAGTGAGTGAGTGAGGAGTTAGGACAGACGATC
rJMSF040J05- CCTTCCCGGCGTTCTTCATCTTCTTAGTGAGTGAGTGAGGAGTTAGGACAGACGATAAC
rJMFF026H20- CCTTCCCGGCGTTCTTCATCTTCTTAGTGAGTGAGTGAGGAGTTAGGACAGACGATAAC
rJMFF021L16- CCTTCCCGGCGTTCTTCATCTTCTTAGTGAGTGAGTGAGGAGTTAGGACAGACGATAAC
JMSF009D16+ CCTTCCCGGCGTTCTTCATCTTCTTAGTGAGTGAGTGAGGAGTTAGGACAGACGATC
JMSF010D16+ CCTTCCCGGCGTTCTTCATCTTCTTAGTGAGTGAGTGAGGAGTTAGGACAGACGATC
JMSF040J05+ CCTTCCCGGCGTTCTTCATCTTCTTAGTGAGTGAGTGAGGAGTTAGGACAGACGATAACC
                      ____________________________________________________________
consensus CCTTCCCGGCGTTCTTCATCTTCTTAGTGAGTGAGTGAGGAGTTAGGACAGACGATAACC