Previous Contig 007357:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS033H06Sequence539007357 (3)gb:BT006158_16390522e-39Arabidopsis thaliana clone RAFL19-54-D12 (R50668) unknown protein (At1g74780) mR
JMSF017N18Sequence498007357 (3)gb:BT006158_16390522e-41Arabidopsis thaliana clone RAFL19-54-D12 (R50668) unknown protein (At1g74780) mR755011984 (2)gb:BT006158_16390527e-37Arabidopsis thaliana clone RAFL19-54-D12 (R50668) unknown protein (At1g74780) mR
JMSF040I20Sequence665007357 (3)gb:BT006158_16390523e-42Arabidopsis thaliana clone RAFL19-54-D12 (R50668) unknown protein (At1g74780) mR875011984 (2)gb:BT006158_16390521e-48Arabidopsis thaliana clone RAFL19-54-D12 (R50668) unknown protein (At1g74780) mR

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS033H06+ AGGGTTATGTATCAAATGGAAAGCTTATGTTAGCAATGGCTGCACTCTGCACTC
JMSF040I20+ CACTC
                      ____________________________________________________________
consensus AGGGTTATGTATCAAATGGAAAGCTTATGTTAGCAATGGCTGCACTCTGCACTC
 
. : . : . : . : . : . :
JMFS033H06+ ATCAAATTGAAATAGGGAAATGCCCAAACACCATAAGTAAGCATTTGCATAATTTTAGGT
JMSF040I20+ ATCAAATTGAAATAGGGAAATGCCCAAACACCATAAGTAAGCATTTGCATAATTTTAGGT
                      ____________________________________________________________
consensus ATCAAATTGAAATAGGGAAATGCCCAAACACCATAAGTAAGCATTTGCATAATTTTAGGT
 
. : . : . : . : . : . :
JMFS033H06+ GATTGGGTGAGAATAAAACCTTCATAATACCAACCACAGTCCCTCTATGTCTGGGGAAAT
JMSF040I20+ GATTGGGTGAGAATCAAACCTTCATAATACCAACCACAGTCCCTCTATGTCTGGGGAAAT
                      ____________________________________________________________
consensus GATTGGGTGAGAATCAAACCTTCATAATACCAACCACAGTCCCTCTATGTCTGGGGAAAT
 
. : . : . : . : . : . :
JMFS033H06+ TATGAACCGCAGTAACAACATTAGCGGTGTTGAAGAAGGTGGTGGCCTGAGCGGCAAGGA
JMSF017N18+ AGCGGTGTTGAAGAAGGTGGTGGCCTGAGCGGCAAGGA
JMSF040I20+ TATGAACCGCAGTAACAACATTAGCGGTGTTGAAGAAGGTGGTGGCCTGAGCGGCAAGGA
                      ____________________________________________________________
consensus TATGAACCGCAGTAACAACATTAGCGGTGTTGAAGAAGGTGGTGGCCTGAGCGGCAAGGA
 
. : . : . : . : . : . :
JMFS033H06+ GCATGTAGAGGCACATGACAAGCACGTGGGGTGCGGGCAGCAAACCCACGACGGTCAACC
JMSF017N18+ GCATGTAGAGGCACATGACAAGCACGTGGGGTGCGGGCAGCAAACCCACGACGGTCAACC
JMSF040I20+ GCATGTAGAGGCACATGACAAGCACGTGGGGTGCGGGCAGCAAACCCACGACGGTCAACC
                      ____________________________________________________________
consensus GCATGTAGAGGCACATGACAAGCACGTGGGGTGCGGGCAGCAAACCCACGACGGTCAACC
 
. : . : . : . : . : . :
JMFS033H06+ ACATGAGGAAGTAGCCGGCGAAGCATAGAAGCGCGCCGACCAAGAGCACCACCCAGGGGC
JMSF017N18+ ACATGAGGAAGTAGCCGGCGAAGCATAGAAGCGCGCCGACCAAGAGCACCACCCAGGGGC
JMSF040I20+ ACATGAGGAAGTAGCCGGCGAAGCATAGAAGCGCGCCGACCAAGAGCACCACCCAGGGGC
                      ____________________________________________________________
consensus ACATGAGGAAGTAGCCGGCGAAGCATAGAAGCGCGCCGACCAAGAGCACCACCCAGGGGC
 
. : . : . : . : . : . :
JMFS033H06+ CGCCACCGCAGGCGGCGGAGTAGAGGAGGCCGGAGAGTACGCCGACGTTGGCGCCGAAGT
JMSF017N18+ CGCCACCGCAGGCGGCGGAGTAGAGGAGGCCGGAGAGTACGCCGACGTTGGCGCCGAAGT
JMSF040I20+ CGCCACCGCAGGCGGCGGAGTAGAGGAGGCCGGAGAGTACGCCGACGTTGGCGCCGAAGT
                      ____________________________________________________________
consensus CGCCACCGCAGGCGGCGGAGTAGAGGAGGCCGGAGAGTACGCCGACGTTGGCGCCGAAGT
 
. : . : . : . : . : . :
JMFS033H06+ CTTTGAAAACGGAAACGGTGTCGAGGGTTGACTGATCATAGGCTTGGGATGATTTCAAGA
JMSF017N18+ CTTTGAAAACGGAAACGGTGTCGAGGGTTGACTGATCATAGGCTTGGGATGATTTCAAGA
JMSF040I20+ CTTTGAAAACGGAAACGGTGTCGAGGGTTGACTGATCATAGGCTTGGGATGATTTCAAGA
                      ____________________________________________________________
consensus CTTTGAAAACGGAAACGGTGTCGAGGGTTGACTGATCATAGGCTTGGGATGATTTCAAGA
 
. : . : . : . : . : . :
JMFS033H06+ CGGAGGAGTAGATGGCGAAGGTGTAGAGAGAGCCGCTGGTGGATTGAATCCATATGCTGG
JMSF017N18+ CGGAGGAGTAGATGGCGAAGGTGTAGAGAGAGCCGCTGGTGGATTGAATCCATATGCTGG
JMSF040I20+ CGGAGGAGTAGATGGCGAAGGTGTAGAGAGAGCCGCTGGTGGATTGAATCCATATGCTGG
                      ____________________________________________________________
consensus CGGAGGAGTAGATGGCGAAGGTGTAGAGAGAGCCGCTGGTGGATTGAATCCATATGCTGG
 
. : . : . : . : . : . :
JMFS033H06+ CCACT
JMSF017N18+ CCACTGTAGCGACCCACTTGCTGTTGATCTTGGTTTTGAATCGAGGGTTGTAATCCGGGT
JMSF040I20+ CCACTGTAGCGACCCACTTGCTGTTGATCTTGGTTTTGAATCGAGGGTTGTAATCCGGGT
                      ____________________________________________________________
consensus CCACTGTAGCGACCCACTTGCTGTTGATCTTGGTTTTGAATCGAGGGTTGTAATCCGGGT
 
. : . : . : . : . : . :
JMSF017N18+ CTAAATCCATTTCCTTCCTTCTTTTTCGTGATGAAATTATAGTTTCGATTAGCCATTTTA
JMSF040I20+ CTAAATCCATTTCCTTCCTTCTTTTTCGTGATGAAATTATAGTTTCGATTAGCCATTTTA
                      ____________________________________________________________
consensus CTAAATCCATTTCCTTCCTTCTTTTTCGTGATGAAATTATAGTTTCGATTAGCCATTTTA
 
. : . : . : . : . : . :
JMSF017N18+ GGTTTTATGGAATTGGGAAGAGGAAGAAGCATGGTGCC
JMSF040I20+ GGTTTTATGGAATTGGGAAGAGGAAGAAGCATGGTGCCAGGTGCCTTGTCTATGTGAGCC
                      ____________________________________________________________
consensus GGTTTTATGGAATTGGGAAGAGGAAGAAGCATGGTGCCAGGTGCCTTGTCTATGTGAGCC