Previous Contig 007347:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS054B02Sequence553007347 (3)gb:AC151815_17451634e-05Solanum demissum chromosome 5 clone PGEC472P22 map MAP_LOC, complete sequence.
JMSF040E22Sequence284007347 (3)846008389 (4)gb:AY663392_16204954e-42Triticum aestivum cultivar Renan clone BAC 930H14, complete sequence.
JMSF052M17Sequence650007347 (3)gb:AC151815_17451634e-07Solanum demissum chromosome 5 clone PGEC472P22 map MAP_LOC, complete sequence.

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF052M17+ AGTAAGAAACAAGGCAATTCGAAAACCTCACAGTTCTTTTTCC
                      ____________________________________________________________
consensus AGTAAGAAACAAGGCAATTCGAAAACCTCACAGTTCTTTTTCC
 
. : . : . : . : . : . :
JMSF052M17+ AGCACGGTCTCTCTCAGCACGTGAAGAAATCCAAAGTTATGAACACAATCAGAGAAATCC
                      ____________________________________________________________
consensus AGCACGGTCTCTCTCAGCACGTGAAGAAATCCAAAGTTATGAACACAATCAGAGAAATCC
 
. : . : . : . : . : . :
JMSF052M17+ ACAAGGCCGATAATATTAGAAAGTCGAAATGGACAAAACTTAGGCCTTCCCTTGAGCCCA
JMFS054B02+ CGAAATGGACAAAACTTAGGCCTTCCCTTGAGCCCA
                      ____________________________________________________________
consensus ACAAGGCCGATAATATTAGAAAGTCGAAATGGACAAAACTTAGGCCTTCCCTTGAGCCCA
 
. : . : . : . : . : . :
JMSF052M17+ TATCTCGGAAAATGACCACCTTTCCTTAAAGCACCCAATGCCTGCAAAATGTCACGATCC
JMFS054B02+ TATCTCGGAAAATGACCACCTTTCCTTAAAGCACCCAATGCCTGCAAAATGTCACGATCC
                      ____________________________________________________________
consensus TATCTCGGAAAATGACCACCTTTCCTTAAAGCACCCAATGCCTGCAAAATGTCACGATCC
 
. : . : . : . : . : . :
JMSF052M17+ GCCATTCCATGAAGAAGCGCAGAACCACCTTCCGCCCTCAAAATCTCCGGTCATCATCAG
JMFS054B02+ GCCATTCCATGAAGAAGCGCAGAACCACCTTCCGCCCTCAAAATCTCCGGTCATCATCAG
                      ____________________________________________________________
consensus GCCATTCCATGAAGAAGCGCAGAACCACCTTCCGCCCTCAAAATCTCCGGTCATCATCAG
 
. : . : . : . : . : . :
JMSF052M17+ CCACGGCGGCGACGCCGGGGCACGCTTCCTCAGACCACCACCCAATTACCGGAACCCTAG
JMFS054B02+ CCACGGCGGCGACGCCGGGGCACGCTTCCTCAGACCACCACCCAATTACCGGAACCCTAG
                      ____________________________________________________________
consensus CCACGGCGGCGACGCCGGGGCACGCTTCCTCAGACCACCACCCAATTACCGGAACCCTAG
 
. : . : . : . : . : . :
JMSF052M17+ CTTAAAAAGCCTCCACCTTTCAACTCTTCTGTGAATACCCACAGATCTGGAGAGCTTCAC
JMFS054B02+ CTTAAAAAGCCTCCACCTTTCAACTCTTCTGTGAATACCCACAGATCTGGAGAGCTTCAC
                      ____________________________________________________________
consensus CTTAAAAAGCCTCCACCTTTCAACTCTTCTGTGAATACCCACAGATCTGGAGAGCTTCAC
 
. : . : . : . : . : . :
JMSF052M17+ CGGAAACCACCGTTACCTTTTCCCTACCGGCAAAGCGCAGCCCACATTGTTAGTACCCTC
JMFS054B02+ CGGAAACCACCGTTACCTTTTCCCTACCGGCAAAGCGCAGCCCACATTGTTAGTACCCTC
                      ____________________________________________________________
consensus CGGAAACCACCGTTACCTTTTCCCTACCGGCAAAGCGCAGCCCACATTGTTAGTACCCTC
 
. : . : . : . : . : . :
JMSF052M17+ CGGTGACCGAAAAAAGAGAGTCTTTATCGGCGTTCCCGCTGACCCACCAGGGAAATTCAA
JMFS054B02+ CGGTGACCGAAAAAAGAGAGTCTTTATCGGCGTTCCCGCTGACCCACCAGGGAAATTCAA
                      ____________________________________________________________
consensus CGGTGACCGAAAAAAGAGAGTCTTTATCGGCGTTCCCGCTGACCCACCAGGGAAATTCAA
 
. : . : . : . : . : . :
JMSF052M17+ AAATTCCGGCGGCGGCGGCCGGAGAAGAATACAGACGGAGGCGGATATGGAGAGAGAGAA
JMFS054B02+ AAATTCCGGCGGCGGCGGCCGGAGAAGAATACAGACGGAGGCGGATATGGAGAGAGAGAA
JMSF040E22+ GGCCGGAGAAGAATACAGNCGGAGGCGGATATGGAGAGAGAGAA
                      ____________________________________________________________
consensus AAATTCCGGCGGCGGCGGCCGGAGAAGAATACAGACGGAGGCGGATATGGAGAGAGAGAA
 
. : . : . : . : . : . :
JMSF052M17+ AGAGATTAACTCCGGCGGAGAAGCGTTGTTAGATTGAGTCAAAGAGGAGGGAAGAAAAGG
JMFS054B02+ AGAGATTAACTCCGGCGGAGAAGCGTTGTTAGATTGAGTCAAAGAGGAGGGAAGAAAAGG
JMSF040E22+ AGAGATTAACTCCGGCGGAGAAGCGTTGTTAGATTGAGTCAAAGAGGAAGGAAGAAAAGG
                      ____________________________________________________________
consensus AGAGATTAACTCCGGCGGAGAAGCGTTGTTAGATTGAGTCAAAGAGGAGGGAAGAAAAGG
 
. : . : . : . : . : . :
JMSF052M17+ GAGTC
JMFS054B02+ GAGTCCAAAATCATCTAAGAAGAAGAAAAGAAAGAAA
JMSF040E22+ GAGTCCAAATTCTTTTAAGAAGAAGAAAAGAAAGAAAACACCATTACTGTGTACGAGTGT
                      ____________________________________________________________
consensus GAGTCCAAATTCTTTTAAGAAGAAGAAAAGAAAGAAAACACCATTACTGTGTACGAGTGT
 
. : . : . : . : . : . :
JMSF040E22+ GAGAAGACATTTTCCCAATGCTTTCTTTTACCACTTTTTTTCCCTNTCCCCATTCCATTG
                      ____________________________________________________________
consensus GAGAAGACATTTTCCCAATGCTTTCTTTTACCACTTTTTTTCCCTNTCCCCATTCCATTG
 
. : . : . : . : . : . :
JMSF040E22+ CATTGCAGTTGTCTTCCCCAAAAAAATATGACCACACTTTTGTTTTTTTCCAAATTAATT
                      ____________________________________________________________
consensus CATTGCAGTTGTCTTCCCCAAAAAAATATGACCACACTTTTGTTTTTTTCCAAATTAATT