Previous Contig 007340:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFN039B16Sequence570007340 (3)gb:AY182777_15878832e-48Lycopersicon esculentum type 5 protein serine/threonine phosphatase 62 kDa isofo
JMSF038M21Sequence705007243 (2)gb:AY182777_15878832e-65Lycopersicon esculentum type 5 protein serine/threonine phosphatase 62 kDa isofo872007340 (3)gb:AY182777_1587883e-101Lycopersicon esculentum type 5 protein serine/threonine phosphatase 62 kDa isofo
JMSF040C10Sequence684007340 (3)gb:AY182777_15878832e-06Lycopersicon esculentum type 5 protein serine/threonine phosphatase 62 kDa isofo866023886

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN039B16+ CGATCAATAACAATCTGNCACAAATGGATACAGATAAA
rJMSF038M21- AATGGATACAGATAAA
                      ____________________________________________________________
consensus CGATCAATAACAATCTGNCACAAATGGATACAGATAAA
 
. : . : . : . : . : . :
JMFN039B16+ CAGAGTGGCAATACATTCCTGACGATCTTGTTATTTGGGCGGGCTATTACAACTAAACCT
rJMSF038M21- CAGAGTGGCAATACATTCCTGACGATCTTGTTATTTGGGCGGGCTATTACAACTAAACCT
                      ____________________________________________________________
consensus CAGAGTGGCAATACATTCCTGACGATCTTGTTATTTGGGCGGGCTATTACAACTAAACCT
 
. : . : . : . : . : . :
JMFN039B16+ ATATTTTCTTTCAACACAAACAAAATCTGTGACAATTCTTATAAGCAGTGAGGAAAGTCC
rJMSF038M21- ATATTTTCTTTCAACACAAACAAAATCTGTGACAATTCTTATAAGCAGTGAGGAAAGTCC
                      ____________________________________________________________
consensus ATATTTTCTTTCAACACAAACAAAATCTGTGACAATTCTTATAAGCAGTGAGGAAAGTCC
 
. : . : . : . : . : . :
JMFN039B16+ CAAAAAATATCGGCTAGAGAATTGTATAGTCAACAAGATCGAGCCAGCCCTACCTTCACC
rJMSF038M21- CAAAAAATATCGGCTAGAGAATTGTATAGTCAACAAGATCGAGCCAGCCCTACCTTCACC
                      ____________________________________________________________
consensus CAAAAAATATCGGCTAGAGAATTGTATAGTCAACAAGATCGAGCCAGCCCTACCTTCACC
 
. : . : . : . : . : . :
JMFN039B16+ CGCCTTTCAGGACAACTCCGCTCTCTGCCAGCAGCTTGCAAAATCCGTTATGCTTGGGGA
rJMSF038M21- CGCCTTTCAGGACAACTCCGCTCTCTGCCAGCAGCTTGCAAAATCCGTTATGCTTGGGGA
                      ____________________________________________________________
consensus CGCCTTTCAGGACAACTCCGCTCTCTGCCAGCAGCTTGCAAAATCCGTTATGCTTGGGGA
 
. : . : . : . : . : . :
JMFN039B16+ CTATGAGAACATCCGAAGGAAGTTGTTGGCATATGCCATTGGCTTGACATCAGGGTGTGG
rJMSF038M21- CTATGAGAACATCCGAAGGAAGTTGTTGGCATATGCCATTGGCTTGACATCAGGGTGTGG
                      ____________________________________________________________
consensus CTATGAGAACATCCGAAGGAAGTTGTTGGCATATGCCATTGGCTTGACATCAGGGTGTGG
 
. : . : . : . : . : . :
JMFN039B16+ CACAGCTGAAAATGTGACAATATTTGGTTTAAGCTGAGGAGCTTGGAAACGGATAAAAGC
rJMSF038M21- CACAGCTGAAAATGTGACAATATTTGGTTTAAGCTCAGGAGCTTGGAAACGGATAAAAGC
                      ____________________________________________________________
consensus CACAGCTGAAAATGTGACAATATTTGGTTTAAGCTGAGGAGCTTGGAAACGGATAAAAGC
 
. : . : . : . : . : . :
JMFN039B16+ TCCCTTGTTACCCATCTGATCACAGTAGTTTGGAGCAGAGAACACAGTGATGAGTTTACC
rJMSF038M21- TCCCTTGTTACCCATCTGATCACAGTAGTTTGGAGCAGAGAACACAGTGATGAGTTTACC
                      ____________________________________________________________
consensus TCCCTTGTTACCCATCTGATCACAGTAGTTTGGAGCAGAGAACACAGTGATGAGTTTACC
 
. : . : . : . : . : . :
JMFN039B16+ ATCATGGTCAATCTCATACCCTTCATCTTTTACTTCATGAGATCGCACAACTAACTCTAG
rJMSF038M21- ATCATGGTCAATCTCATACCCTTCATCTTTTACTTCATGAGATCGCACAACTAACTCTAG
                      ____________________________________________________________
consensus ATCATGGTCAATCTCATACCCTTCATCTTTTACTTCATGAGATCGCACAACTAACTCTAG
 
. : . : . : . : . : . :
JMFN039B16+ ATTATTGTCCTGCAAAAATCTTTTTGTTACATCCCCGCCAAATGAGAGACCA
rJMSF038M21- ATTATTGTCCTGCAAAAATCTTTTTGTTACATCCCCGCCAAATGAGAGACCAACACCACG
                      ____________________________________________________________
consensus ATTATTGTCCTGCAAAAATCTTTTTGTTACATCCCCGCCAAATGAGAGACCAACACCACG
 
. : . : . : . : . : . :
rJMSF038M21- TTTACTAGGTCCTCTCCCAGGTTGAGGTTGTGGATCACTCCACAAAAGTTCACACATCAA
                      ____________________________________________________________
consensus TTTACTAGGTCCTCTCCCAGGTTGAGGTTGTGGATCACTCCACAAAAGTTCACACATCAA
 
. : . : . : . : . : . :
rJMSF038M21- CCCTTCTTCTGGTGGCTCACAAAACCGATCAATTGCCCTAATATCAGAGAGCTTCACACC
JMSF040C10+ ACCGATCAATTGCTCTAATATTAGAGAGCTTCACACC
                      ____________________________________________________________
consensus CCCTTCTTCTGGTGGCTCACAAAACCGATCAATTGCTCTAATATTAGAGAGCTTCACACC
 
. : . : . : . : . : . :
rJMSF038M21- ATCAACACTAAAAAGCCCTCCGTGGACAACAA
JMSF040C10+ ATCAACACTAAAAAGCCCTCCGTGGACAACAAGAAATAAGAATCTTCCCATAGGTAAGGA
                      ____________________________________________________________
consensus ATCAACACTAAAAAGCCCTCCGTGGACAACAAGAAATAAGAATCTTCCCATAGGTAAGGA
 
. : . : . : . : . : . :
JMSF040C10+ TAAACAACAAATTACTTCAGCAAATTTCAAGCATAAGAAGCATAAATGAAATTTTACCCG
                      ____________________________________________________________
consensus TAAACAACAAATTACTTCAGCAAATTTCAAGCATAAGAAGCATAAATGAAATTTTACCCG
 
. : . : . : . : . : . :
JMSF040C10+ TACAGGGTGTCTTCTTCGTATTCTGGTCGCCACCGTCGGAACCCAGCCATCCTCCGTCGT
                      ____________________________________________________________
consensus TACAGGGTGTCTTCTTCGTATTCTGGTCGCCACCGTCGGAACCCAGCCATCCTCCGTCGT
 
. : . : . : . : . : . :
JMSF040C10+ CTCTCTTCACCGCAGCACCAAATGGTTGCGCTATTCGACAGATTTTGCCCTAGCCGACAG
                      ____________________________________________________________
consensus CTCTCTTCACCGCAGCACCAAATGGTTGCGCTATTCGACAGATTTTGCCCTAGCCGACAG
 
. : . : . : . : . : . :
JMSF040C10+ ATCTCGAGTCTCAACCAGTTGAGATACTAAATCGGCGGAACAGATCTGAAGATGGCGGCA
                      ____________________________________________________________
consensus ATCTCGAGTCTCAACCAGTTGAGATACTAAATCGGCGGAACAGATCTGAAGATGGCGGCA
 
. : . : . : . : . : . :
JMSF040C10+ ACGGCGGTGGCGGTGCGTGGAAGGCGGCGGCGGCTCATCGTGGCGGTGGCGTTGTTAAAG
                      ____________________________________________________________
consensus ACGGCGGTGGCGGTGCGTGGAAGGCGGCGGCGGCTCATCGTGGCGGTGGCGTTGTTAAAG
 
. : . : . : . : . : . :
JMSF040C10+ CTTTGTCTCCCTCCAATCGGCGAAGAAACTACTGGAAGAGAGAAAAAGCTAAAGTGGAGA
                      ____________________________________________________________
consensus CTTTGTCTCCCTCCAATCGGCGAAGAAACTACTGGAAGAGAGAAAAAGCTAAAGTGGAGA
 
. : . : . : . : . : . :
JMSF040C10+ GGAGAGTAAAATCTAAATGGAAGAAACATTATAATGCTGTTGGGATTATTTTTCGCGGCC
                      ____________________________________________________________
consensus GGAGAGTAAAATCTAAATGGAAGAAACATTATAATGCTGTTGGGATTATTTTTCGCGGCC