Previous Contig 007339:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFN005H12Sequence607007339 (3)pir|F84434|F844344e-46lectin-like protein [imported] - Arabidopsis thaliana>gb:AC005312_1532516 Arabid
JMSF040C06Sequence670007339 (3)pir|F84434|F844343e-48lectin-like protein [imported] - Arabidopsis thaliana>gb:AC005312_1532516 Arabid811007339 (3)pir|E84434|E844341e-47probable phloem-specific lectin [imported] - Arabidopsis thaliana>gb:AC005312_15

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF040C06- GCCTGATCTCAATCCCTTGCACAATGATGCCGCCCTTAGGCTGCCCACC
                      ____________________________________________________________
consensus GCCTGATCTCAATCCCTTGCACAATGATGCCGCCCTTAGGCTGCCCACC
 
. : . : . : . : . : . :
rJMSF040C06- ATGCACCTCCATCAAACTAATCTCTACCCAGTCTTCTTCTTCACTACCTCTGATGAAAAT
                      ____________________________________________________________
consensus ATGCACCTCCATCAAACTAATCTCTACCCAGTCTTCTTCTTCACTACCTCTGATGAAAAT
 
. : . : . : . : . : . :
rJMSF040C06- CTCTCCCAATTCAACTTCCATCCATTTATCGCCTCTCCCCTTTGGGTGTTCGCCATCTGG
                      ____________________________________________________________
consensus CTCTCCCAATTCAACTTCCATCCATTTATCGCCTCTCCCCTTTGGGTGTTCGCCATCTGG
 
. : . : . : . : . : . :
rJMSF040C06- GGGTGGATTCGCGTTTTGTCCAGTTTGGCGATGACCAAGTTGCCCCATTCGCCATGACCT
                      ____________________________________________________________
consensus GGGTGGATTCGCGTTTTGTCCAGTTTGGCGATGACCAAGTTGCCCCATTCGCCATGACCT
 
. : . : . : . : . : . :
rJMSF040C06- CTCCGCTTCATCCGGATCCAATTCCCACGGACCAAGCTTGGTTCTTGGCCTTACCAGCAC
JMSF040C06+ TTACCAGCAC
                      ____________________________________________________________
consensus CTCCGCTTCATCCGGATCCAATTCCCACGGACCAAGCTTGGTTCTTGGCCTTACCAGCAC
 
. : . : . : . : . : . :
rJMSF040C06- TTTTTTGGGATCCAGGTAAACAATCCTTGTTACAGCCTCCTGGCCGATAATCCTGACTAA
JMFN005H12+ GGCCGATAATCCTGACTAA
JMSF040C06+ TTTTTTGGGATCCAGGTAAACAATCCTTGTTACAGCCTCCTGGCCGATAATCCTGACTAA
                      ____________________________________________________________
consensus TTTTTTGGGATCCAGGTAAACAATCCTTGTTACAGCCTCCTGGCCGATAATCCTGACTAA
 
. : . : . : . : . : . :
rJMSF040C06- AGCATCCACAGGTTGGGATTCAAAGCCATAGATGTTTGCTCTCACTCTGAACACAAGGTA
JMFN005H12+ AGCATCCACAGGTTGGGATTCAAAGCCATAGATGTTTGCTCTCACTCTGAACACAAGGTA
JMSF040C06+ AGCATCCACAGGTTGGGATTCAAAGCCATAGATGTTTGCTCTCACTCTGAACACAAGGTA
                      ____________________________________________________________
consensus AGCATCCACAGGTTGGGATTCAAAGCCATAGATGTTTGCTCTCACTCTGAACACAAGGTA
 
. : . : . : . : . : . :
rJMSF040C06- TGCTGCATAGTTAGTATCTGGCGACAACATCTTTGTACTAATCTTGCCACGAATTTCAAA
JMFN005H12+ TGCTGCATAGTTAGTATCTGGCGACAACATCTTTGTACTAATCTTGCCACGAATTTCAAA
JMSF040C06+ TGCTGCATAGTTAGTATCTGGCGACAACATCTTTGTACTAATCTTGCCACGAATTTCAAA
                      ____________________________________________________________
consensus TGCTGCATAGTTAGTATCTGGCGACAACATCTTTGTACTAATCTTGCCACGAATTTCAAA
 
. : . : . : . : . : . :
rJMSF040C06- CCACCATACGTGCAATAGCTCATTAACTTCGGAGAACCTTGATCCAGGAAGAGAAAGACA
JMFN005H12+ CCACCATACGTGCAATAGCTCATTAACTTCGGAGAACCTTGATCCAGGAAGAGAAAGACA
JMSF040C06+ CCACCATACGTGCAATAGCTCATTAACTTCGGAGAACCTTGATCCAGGAAGAGAAAGACA
                      ____________________________________________________________
consensus CCACCATACGTGCAATAGCTCATTAACTTCGGAGAACCTTGATCCAGGAAGAGAAAGACA
 
. : . : . : . : . : . :
rJMSF040C06- CCTCCAATATCTAGCATCATTGCCCCAAGCAATGTCGAGTGACCTTGCAGCTAACATGTA
JMFN005H12+ CCTCCAATATCTAGCATCATTGCCCCAAGCAATGTCGAGTGACCTTGCAGCTAACATGTA
JMSF040C06+ CCTCCAATATCTAGCATCATTGCCCCAAGCAATGTCGAGTGACCTTGCAGCTAACATGTA
                      ____________________________________________________________
consensus CCTCCAATATCTAGCATCATTGCCCCAAGCAATGTCGAGTGACCTTGCAGCTAACATGTA
 
. : . : . : . : . : . :
rJMSF040C06- ACATTTCTTCCCACTCGTTTTGTCCAGTGAAAAACTCTTAGCGCCGCAGTCAATAATTAC
JMFN005H12+ ACATTTCTTCCCACTCGTTTTGTCCAGTGAAAAACTCTTAGCGCCGCAGTCAATAATTAC
JMSF040C06+ ACATTTCTTCCCACTCGTTTTGTCCAGTGAAAAACTCTTAGCGCCGCAGTCAATAATTAC
                      ____________________________________________________________
consensus ACATTTCTTCCCACTCGTTTTGTCCAGTGAAAAACTCTTAGCGCCGCAGTCAATAATTAC
 
. : . : . : . : . : . :
rJMSF040C06- GGGATGATCGCAGAGGTAGAAGTAGAGATCCTTCTTCGAGGTAAAGGCGAGCAAATCGCC
JMFN005H12+ GGGATGATCGCAGAGGTAGAAGTAGAGATCCTTCTTCGAGGTAAAGGCGAGCAAATCGCC
JMSF040C06+ GGGATGATCGCAGAGGTAGAAGTAGAGATCCTTCTTCGAGGTAAAGGCGAGCAAATCGCC
                      ____________________________________________________________
consensus GGGATGATCGCAGAGGTAGAAGTAGAGATCCTTCTTCGAGGTAAAGGCGAGCAAATCGCC
 
. : . : . : . : . : . :
rJMSF040C06- GGCGTTAGTGGCCCGGGAAACGAGGTCGCGGTAATCGGGAGGCAAGAACCGTTCCCAGAC
JMFN005H12+ GGCGTTAGTGGCCCGGGAAACGAGGTCGCGGTAATCGGGAGGCAAGAACCGTTCCCAGAC
JMSF040C06+ GGCGTTAGTGGCCCGGGAAACGAGGTCGCGGTAATCGGGAGGCAAGAACCGTTCCCAGAC
                      ____________________________________________________________
consensus GGCGTTAGTGGCCCGGGAAACGAGGTCGCGGTAATCGGGAGGCAAGAACCGTTCCCAGAC
 
. : . : . : . : . : . :
rJMSF040C06- GGCGTCGAATTGTGCTGCGGAATGAAAGTTGGAGGCCACCAG
JMFN005H12+ GGCGTCGAATTGTGCTGCGGAATGAAAGTTGGAGGCCACCAGGGACAGACGACAGGCGTC
JMSF040C06+ GGCGTCGAATTGTGCTGCGGAATGAAAGTTGGAGGCCACCAGGGACAGACGACAGGCGTC
                      ____________________________________________________________
consensus GGCGTCGAATTGTGCTGCGGAATGAAAGTTGGAGGCCACCAGGGACAGACGACAGGCGTC
 
. : . : . : . : . : . :
JMFN005H12+ CTTAGGCGTCGTCATCGACAGCGCGTTCGCTATGCAATTCTCAGGCAGCATCGCGAAGAT
JMSF040C06+ CTTAGGCGTCGTCATCGACAGCGCGTTCGCTATGCAATTCTCAGGCAGCATCGCGAAGAT
                      ____________________________________________________________
consensus CTTAGGCGTCGTCATCGACAGCGCGTTCGCTATGCAATTCTCAGGCAGCATCGCGAAGAT
 
. : . : . : . : . : . :
JMFN005H12+ ATCCGCGCCGGTAACGTTCTCCACCGCCATTTCTTAATCTCAGTTGTG
JMSF040C06+ ATCCGCGCCGGTAACGTTCTCCACCGCCATTTCTTAATCTCAGTTGTGGGATAGTCGGAC
                      ____________________________________________________________
consensus ATCCGCGCCGGTAACGTTCTCCACCGCCATTTCTTAATCTCAGTTGTGGGATAGTCGGAC