Previous Contig 007334:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF003A17Sequence483007334 (6)sp|P93338|GAPN_NICPL3e-61NADP-dependent glyceraldehyde-3-phosphate dehydrogenase (EC 1.2.1.9) (Non-phosph709002367 (5)sp|P93338|GAPN_NICPL1e-94NADP-dependent glyceraldehyde-3-phosphate dehydrogenase (EC 1.2.1.9) (Non-phosph
JMFF007B13Sequence480007334 (6)sp|P93338|GAPN_NICPL1e-60NADP-dependent glyceraldehyde-3-phosphate dehydrogenase (EC 1.2.1.9) (Non-phosph672002367 (5)sp|P93338|GAPN_NICPL2e-93NADP-dependent glyceraldehyde-3-phosphate dehydrogenase (EC 1.2.1.9) (Non-phosph
JMFF033J20Sequence569007334 (6)sp|P93338|GAPN_NICPL1e-78NADP-dependent glyceraldehyde-3-phosphate dehydrogenase (EC 1.2.1.9) (Non-phosph666002367 (5)sp|P93338|GAPN_NICPL2e-97NADP-dependent glyceraldehyde-3-phosphate dehydrogenase (EC 1.2.1.9) (Non-phosph
JMFS132C10Sequence617007334 (6)sp|P93338|GAPN_NICPL6e-91NADP-dependent glyceraldehyde-3-phosphate dehydrogenase (EC 1.2.1.9) (Non-phosph
JMFS153D07Sequence615007334 (6)sp|P93338|GAPN_NICPL2e-91NADP-dependent glyceraldehyde-3-phosphate dehydrogenase (EC 1.2.1.9) (Non-phosph
JMSF040A08Sequence668007334 (6)sp|P93338|GAPN_NICPL2e-97NADP-dependent glyceraldehyde-3-phosphate dehydrogenase (EC 1.2.1.9) (Non-phosph837002367 (5)sp|P93338|GAPN_NICPLe-122NADP-dependent glyceraldehyde-3-phosphate dehydrogenase (EC 1.2.1.9) (Non-phosph

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF040A08+ TAGTGAGTT
                      ____________________________________________________________
consensus TAGTGAGTT
 
. : . : . : . : . : . :
JMFS132C10+ TTGGAGACAGCAAGATTGACAGGATAGTTAAACGG
JMFS153D07+ TTGGAGACAGCAAGATTGACAGGATAGTTAAACGG
JMSF040A08+ CCCGGCAATCAGAGCGGGTGCTATTTTGGAGACAGCAAGATTGACAGGATAGTTAAACGG
                      ____________________________________________________________
consensus CCCGGCAATCAGAGCGGGTGCTATTTTGGAGACAGCAAGATTGACAGGATAGTTAAACGG
 
. : . : . : . : . : . :
JMFS132C10+ TGGAATGGCTAAAACCACACCGAGTGGAATCTTTGAAGTAAGGCAGTACTTGGTCCTCTC
JMFS153D07+ TGGAATGGCTAAAACCACACCGAGTGGAATCTTTGAAGTAAGGCAGTACTTGGTCCTCTC
JMFF033J20+ TCTTTGAAGTAAGGCAGTACTTGGTCCTCTC
JMSF040A08+ TGGAATGGCTAAAACCACACCGAGTGGAATCTTTGAAGTAAGGCAGTACTTGGTCCTCTC
                      ____________________________________________________________
consensus TGGAATGGCTAAAACCACACCGAGTGGAATCTTTGAAGTAAGGCAGTACTTGGTCCTCTC
 
. : . : . : . : . : . :
JMFS132C10+ GTTTCCAGGAAAACTATCGGATACCAAAAATTTTCCTTCCCCCAAAATGCGAACACCTTC
JMFS153D07+ GTTTCCAGGAAAACTATCGGATACCAAAAATTTTCCTTCCCCCAAAATGCGAACACCTTC
JMFF033J20+ GTTTCCAGGAAAACTATCGGATACCAAAAATTTTCCTTCCCCCAAAATGCGAACACCTTC
JMFF007B13+ TC
JMFF003A17+ CCTTC
JMSF040A08+ GTTTCCAGGAAAACTATCGGATACCAAAAATTTTCCTTCCCCCAAAATGCGAACACCTTC
                      ____________________________________________________________
consensus GTTTCCAGGAAAACTATCGGATACCAAAAATTTTCCTTCCCCCAAAATGCGAACACCTTC
 
. : . : . : . : . : . :
JMFS132C10+ TTCAGCAGTGTAAGAGACCAAATCTCCAGACCTTACAACCTCGGTTACAGCATCTTTAGC
JMFS153D07+ TTCAGCAGTGTAAGAGACCAAATCTCCAGACCTTACAACCTCGGTTACAGCATCTTTAGC
JMFF033J20+ TTCAGCAGTGTAAGAGACCAAATCTCCAGACCTTACAACCTCGGTTACAGCATCTTTAGC
JMFF007B13+ TTCAGCAGTGTAAGAGACCAAATCTCCAGACCTTACAACCTCGGTTACAGCATCTTTAGC
JMFF003A17+ TTCAGCAGTGTAAGAGACCAAATCTCCAGACCTTACAACCTCGGTTACAGCATCTTTAGC
JMSF040A08+ TTCAGCAGTGTAAGAGACCAAATCTCCAGACCTTACAACCTCGGTTACAGCATCTTTAGC
                      ____________________________________________________________
consensus TTCAGCAGTGTAAGAGACCAAATCTCCAGACCTTACAACCTCGGTTACAGCATCTTTAGC
 
. : . : . : . : . : . :
JMFS132C10+ TGGTTTTGCAATTTCCTTTACTAAACACTCTGCAATCGGGGCTTTGTGTTCTTTCAGAAT
JMFS153D07+ TGGTTTTGCAATTTCCTTTACTAAACACTCTGCAATCGGGGCTTTGTGTTCTTTCAGAAT
JMFF033J20+ TGGTTTTGCAATTTCCTTTACTAAACACTCTGCAATCGGGGCTTTGTGTTCTTTCAGAAT
JMFF007B13+ TGGTTTTGCAATTTCCTTTACTAAACACTCTGCAATCGGGGCTTTGTGTTCTTTCAGAAT
JMFF003A17+ TGGTTTTGCAATTTCCTTTACTAAACACTCTGCAATCGGGGCTTTGTGTTCTTTCAGAAT
JMSF040A08+ TGGTTTTGCAATTTCCTTTACTAAACACTCTGCAATCGGGGCTTTGTGTTCTTTCAGAAT
                      ____________________________________________________________
consensus TGGTTTTGCAATTTCCTTTACTAAACACTCTGCAATCGGGGCTTTGTGTTCTTTCAGAAT
 
. : . : . : . : . : . :
JMFS132C10+ GGCGGCTGCCTTGTGAAGGAGCTCTGCTCTCTTCCAAAGTGGGGTTTTTGCCCACAATTT
JMFS153D07+ GGCGGCTGCCTTGTGAAGGAGCTCTGCTCTCTTCCAAAGTGGGGTTTTTGCCCACAATTT
JMFF033J20+ GGCGGCTGCCTTGTGAAGGAGCTCTGCTCTCTTCCAAAGTGGGGTTTTTGCCCACAATTT
JMFF007B13+ GGCGGCTGCCTTGTGAAGGAGCTCTGCTCTCTTCCAAAGTGGGGTTTTTGCCCACAATTT
JMFF003A17+ GGCGGCTGCCTTGTGAAGGAGCTCTGCTCTCTTCCAAAGTGGGGTTTTTGCCCACAATTT
JMSF040A08+ GGCGGCTGCCTTGTGAAGGAGCTCTGCTCTCTTCCAAAGTGGGGTTTTTGCCCACAATTT
                      ____________________________________________________________
consensus GGCGGCTGCCTTGTGAAGGAGCTCTGCTCTCTTCCAAAGTGGGGTTTTTGCCCACAATTT
 
. : . : . : . : . : . :
JMFS132C10+ TTGCGCGGCTTTTGCATTTTCCATTACCTTGTTCACCTCTTCTTGTGTGCAGGCTTGAAC
JMFS153D07+ TTGCGCGGCTTTTGCATTTTCCATTACCTTGTTCACCTCTTCTTGTGTGCAGGCTTGAAC
JMFF033J20+ TTGCGCGGCTTTTGCATTTTCCATTACCTTGTTCACCTCTTCTTGTGTGCAGGCTTGAAC
JMFF007B13+ TTGCGCGGCTTTTGCATTTTCCATTACCTTGTTCACCTCTTCTTGTGTGCAGGCTTGAAC
JMFF003A17+ TTGCGCGGCTTTTGCATTTTCCATTACCTTGTTCACCTCTTCTTGTGTGCAGGCTTGAAC
JMSF040A08+ TTGCGCGGCTTTTGCATTTTCCATTACCTTGTTCACCTCTTCTTGTGTGCAGGCTTGAAC
                      ____________________________________________________________
consensus TTGCGCGGCTTTTGCATTTTCCATTACCTTGTTCACCTCTTCTTGTGTGCAGGCTTGAAC
 
. : . : . : . : . : . :
JMFS132C10+ TTTGTACTGAGTCTTTCTTGTAGTTGGGTTGATGATAGCCACCGACTTCCCCGAGACAGA
JMFS153D07+ TTTGTACTGAGTCTTTCTTGTAGTTGGGTTGATGATAGCCACCGACTTCCCCGAGACAGA
JMFF033J20+ TTTGTACTGAGTCTTTCTTGTAGTTGGGTTGATGATAGCCACCGACTTCCCCGAGACAGA
JMFF007B13+ TTTGTACTGAGTCTTTCTTGTAGTTGGGTTGATGATAGCCACCGACTTCCCCGAGACAGA
JMFF003A17+ TTTGTACTGAGTCTTTCTTGTAGTTGGGTTGATGATAGCCACCGACTTCCCCGAGACAGA
JMSF040A08+ TTTGTACTGAGTCTTTCTTGTAGTTGGGTTGATGATAGCCACCGACTTCCCCGAGACAGA
                      ____________________________________________________________
consensus TTTGTACTGAGTCTTTCTTGTAGTTGGGTTGATGATAGCCACCGACTTCCCCGAGACAGA
 
. : . : . : . : . : . :
JMFS132C10+ TTTCCTCCACTCTCCTTCCGAGTAGTACTTGAAGACCTCCCCTTCAATGATCTCTGCAAA
JMFS153D07+ TTTCCTCCACTCTCCTTCCGAGTAGTACTTGAAGACCTCCCCTTCAATGATCTCTGCAAA
JMFF033J20+ TTTCCTCCACTCTCCTTCCGAGTAGTACTTGAAGACCTCCCCTTCAATGATCTCTGCAAA
JMFF007B13+ TTTCCTCCACTCTCCTTCCGAGTAGTACTTGAAGACCTCCCCTTCAATGATCTCTGCAAA
JMFF003A17+ TTTCCTCCACTCTCCTTCCGAGTAGTACTTGAAGACCTCCCCTTCAATGATCTCTGCAAA
JMSF040A08+ TTTCCTCCACTCTCCTTCCGAGTAGTACTTGAAGACCTCCCCTTCAATGATCTCTGCAAA
                      ____________________________________________________________
consensus TTTCCTCCACTCTCCTTCCGAGTAGTACTTGAAGACCTCCCCTTCAATGATCTCTGCAAA
 
. : . : . : . : . : . :
JMFS132C10+ AACTCCATTTTGGGTCATTGCTACCGATGCAAAGG-CCCTTGTGGGTAGAGAAATTAGAG
JMFS153D07+ AACTCCATTTTGGGTCATTGCTACCGATGCAAAGGCCCCTTGTGGGTAGAGAAATTAGAG
JMFF033J20+ AACTCCATTTTGGGTCATTGCTACCGATGCAAAGG-CCCTTGTGGGTAGAGAAATTAGAG
JMFF007B13+ AACTCCATTTTGGGTCATTGCTACCGATGCAAAGG-CCCTTGTGGGTAGAGAAATTAGAG
JMFF003A17+ AACTCCATTTTGGGTCATTGCTACCGATGCAAAGG-CCCTTGTGGGTAGAGAAATTAGAG
JMSF040A08+ AACTCCATTTTGGGTCATTGCTACCGATGCAAAGG-CCCTTGTGGGTAGAGAAATTAGAG
                      ____________________________________________________________
consensus AACTCCATTTTGGGTCATTGCTACCGATGCAAAGG-CCCTTGTGGGTAGAGAAATTAGAG
 
. : . : . : . : . : . :
JMFS132C10+ AGAGGAGACGAGAAATGATTGAAGAAAGTTTGAGTGTGAGTGA
JMFS153D07+ AGAGGAGACGAGAAATGATTGAAGAAAGTTTGAGTGTGA
JMFF033J20+ AGAGGAGACGAGAAATGATTGAAGAAAGTTTGAGTGTGAGTGAGAAGTGTGAGGTTTAT
JMFF007B13+ AGAGGAGACGAGAAATGATTGAAGAAAGTTTGAGTGTGAGTGAGAAGTGTGAGGTTTAT
JMFF003A17+ AGAGGAGACGAGAAATGATTGAAGAAAGTTTGAGTGTGAGTGAGAAGTGTGAGGTTTAT
JMSF040A08+ AGAGGAGACGAGAAATGATTGAAGAAAGTTTGAGTGTGAGTGAGAAGTGTGAGGTTTATC
                      ____________________________________________________________
consensus AGAGGAGACGAGAAATGATTGAAGAAAGTTTGAGTGTGAGTGAGAAGTGTGAGGTTTATC