Previous Contig 007320:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF039M08Sequence611007320 (4)gb:AC134346_17417515e-50Oryza sativa (japonica cultivar-group) chromosome 5 clone P0018A03, complete seq847010322 (4)gb:BVU64903_16432312e-59Beta vulgaris putative sugar transporter (BvcDNA-397) mRNA, complete cds.
JMSF039N06Sequence236007320 (4)
JMSF045H21Sequence786007320 (4)gb:AC134346_17417512e-78Oryza sativa (japonica cultivar-group) chromosome 5 clone P0018A03, complete seq103024159pir|E84833|E848330.003hypothetical protein At2g40760 [imported] - Arabidopsis thaliana>gb:AC007660_153
JMSF046H21Sequence379007320 (4)gb:AC134346_17417512e-11Oryza sativa (japonica cultivar-group) chromosome 5 clone P0018A03, complete seq

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF045H21+ GGAATGCAGCGGTACATGGATTTACTGCACCTTTGAACTTCCC
                      ____________________________________________________________
consensus GGAATGCAGCGGTACATGGATTTACTGCACCTTTGAACTTCCC
 
. : . : . : . : . : . :
JMSF045H21+ AATTCTCGTTTCATAGTCATTGCGCACATCAATAACAACAACATCTGGATCACTTATCAA
                      ____________________________________________________________
consensus AATTCTCGTTTCATAGTCATTGCGCACATCAATAACAACAACATCTGGATCACTTATCAA
 
. : . : . : . : . : . :
JMSF045H21+ CGCATTCCAATCCTTTGGCTTAATGTATTTGCCAACTCTTTCAATTGGCGAGACGGATGG
                      ____________________________________________________________
consensus CGCATTCCAATCCTTTGGCTTAATGTATTTGCCAACTCTTTCAATTGGCGAGACGGATGG
 
. : . : . : . : . : . :
JMSF045H21+ CATGCCAAGGGTGACTATCTCTTTCTTCAGCTTAACCCTAACATGATCCCATCGAAACGG
JMSF039M08+ CTTCAGCTTAACCCTAACATGATCCCATCGAAACGG
                      ____________________________________________________________
consensus CATGCCAAGGGTGACTATCTCTTTCTTCAGCTTAACCCTAACATGATCCCATCGAAACGG
 
. : . : . : . : . : . :
JMSF045H21+ AGCATCTTCACCAGCAGCAAGAGGGGAGCTGCTCGTATGTCCTTGATGAATAGCCTCTTC
JMSF039M08+ AGCATCTTCACCAGCAGCAAGAGGGGAGCTGCTCGTATGTCCTTGATGAATAGCCTCTTC
                      ____________________________________________________________
consensus AGCATCTTCACCAGCAGCAAGAGGGGAGCTGCTCGTATGTCCTTGATGAATAGCCTCTTC
 
. : . : . : . : . : . :
JMSF045H21+ CTCAGGACTCACTGGTGACTCCACCCGTCTAAGTCCCTTTAGGCGGTCATCACGTTGAAT
JMSF039M08+ CTCAGGACTCACTGGTGACTCCACCCGTCTAAGTCCCTTTAGGCGGTCATCACGTTGAAT
                      ____________________________________________________________
consensus CTCAGGACTCACTGGTGACTCCACCCGTCTAAGTCCCTTTAGGCGGTCATCACGTTGAAT
 
. : . : . : . : . : . :
JMSF045H21+ GAATGCAAGAACCTCTTCCACTGATTCCCGGGTGCCACATACGCTGCCATTTATTCCTTC
JMSF039M08+ GAATGCAAGAACCTCTTCCACTGATTCCCGGGTGCCACATACGCTGCCATTTATTCCTTC
                      ____________________________________________________________
consensus GAATGCAAGAACCTCTTCCACTGATTCCCGGGTGCCACATACGCTGCCATTTATTCCTTC
 
. : . : . : . : . : . :
JMSF046H21+ CAAGAATAATACCACNTGACACGAGCAGTTGCTCACAGAGCTCCTTCAATGGCTT
JMSF045H21+ TGGTGCAAGAATAATACCACCTGACACGAGCAGTTGCTCACAGAGCTCCTTCAATGGCTT
JMSF039M08+ TGGTGCAAGAATAATACCACCTGACACGAGCAGTTGCTCACAGAGCTCCTTCAATGGCTT
                      ____________________________________________________________
consensus TGGTGCAAGAATAATACCACCTGACACGAGCAGTTGCTCACAGAGCTCCTTCAATGGCTT
 
. : . : . : . : . : . :
JMSF046H21+ CCTAAGCTCGGCGTGGTCGGGAAAATCCGCAAANTTATAGAAGGAAACAACCACCAGCTT
JMSF045H21+ CCTAAGCTCGGCGTGGTCGGGAAAATCCGCAAACTTATAGAAGGAAACAACCACCAGCTT
JMSF039M08+ CCTAAGCTCGGCGTGGTCGGGAAAATCCGCAAACTTATAGAAGGAAACAACCACCAGCTT
                      ____________________________________________________________
consensus CCTAAGCTCGGCGTGGTCGGGAAAATCCGCAAACTTATAGAAGGAAACAACCACCAGCTT
 
. : . : . : . : . : . :
JMSF046H21+ AGGCTCCGTGCTGGTGGAGTCGGACTCTTCATTTCCCAATTCGGCCGCCGGCGGAATGGG
JMSF045H21+ AGGCTCCGTGCTGGTGGAGTCGGACTCTTCATTTCCCAATTCGGCCGCCGGCGGAATGGG
JMSF039M08+ AGGCTCCGTGCTGGTGGAGTCGGACTCTTCATTTCCCAATTCGGCCGCCGGCGGAATGGG
                      ____________________________________________________________
consensus AGGCTCCGTGCTGGTGGAGTCGGACTCTTCATTTCCCAATTCGGCCGCCGGCGGAATGGG
 
. : . : . : . : . : . :
JMSF046H21+ AATAGAATTCGTGGCAGGTGTAGAAGCGAAGCATTTGGAGATAGTAGCATTTTNAGCTNC
JMSF045H21+ AATAGAATTCGTGGCAGGTGTAGAAGCGAAGCATTTGGAGATAGTAGCATTTTGAGCTGC
JMSF039M08+ AATAGAATTCGTGGCAGGTGTAGAAGCGAAGCATTTGGAGATAGTCGCATTTTGAGCTGC
                      ____________________________________________________________
consensus AATAGAATTCGTGGCAGGTGTAGAAGCGAAGCATTTGGAGATAGTAGCATTTTGAGCTGC
 
. : . : . : . : . : . :
JMSF046H21+ GGTGGAGAGAGCGATTTTGGGATTGGAAAAGAAAGGGAAGCTTAGCGCCNCCGCTNATGG
JMSF045H21+ GGTGGAGAGAGCGATTTTGGGATTGGAAAAGAAAGGGAAGCTTAGCGCCGCCGCTGATGG
JMSF039M08+ GGTGGAGAGAGCGATTTTGGGATTGGAAAAGAAAGGGAAGCTTAGCGCCGCCGCTGATGG
JMSF039N06+ GGAGAGANCGATTTTGGGANTGGAAAAGAAAGGGAAGCTTAGCGCCGCCGNTGATGG
                      ____________________________________________________________
consensus GGTGGAGAGAGCGATTTTGGGATTGGAAAAGAAAGGGAAGCTTAGCGCCGCCGCTGATGG
 
. : . : . : . : . : . :
JMSF046H21+ TGGTTCCGAGGTGGATTTCATGGCGGGATCGGCGGAGGATAGGGTTAGGGTTTGGGGAAA
JMSF045H21+ TGGTTCCGAGGTGGATTTCATGGCGGGA-CGGCGGAGGATAGGGTTAGGGTTTGGGGAAA
JMSF039M08+ TGGTTCCGAGGTGGATTTCATGGCGGGA-CGGCGGAGGATAGGGTTAGGGTTTGGGGAAA
JMSF039N06+ TGNTTCCGAGGTGGATTTCATGGCGGGA-CGGCGGAGGATAGGGTTAGGGTTTGGGGAAA
                      ____________________________________________________________
consensus TGGTTCCGAGGTGGATTTCATGGCGGGA-CGGCGGAGGATAGGGTTAGGGTTTGGGGAAA
 
. : . : . : . : . : . :
JMSF046H21+ TANTTGAGGATGTGGACATCA
JMSF045H21+ TAGTTGAGGATGTGGACATCA
JMSF039M08+ TAGTTGAGGATGTGGACATCATTCTCAGCGCCGCC
JMSF039N06+ TAGTTGNGGATGTGGACATCATTNTCCGCGCCGCCACTGACGCCGTTNTCCTAAAGGAAG
                      ____________________________________________________________
consensus TAGTTGAGGATGTGGACATCATTCTCCGCGCCGCCACTGACGCCGTTNTCCTAAAGGAAG
 
. : . : . : . : . : . :
JMSF039N06+ GGATAACCGCTTGCATTGAGACGGTGACGGTCGCTTCCATCTCCATCCATTTCTTGCCTC
                      ____________________________________________________________
consensus GGATAACCGCTTGCATTGAGACGGTGACGGTCGCTTCCATCTCCATCCATTTCTTGCCTC