Previous Contig 007318:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF039M24Sequence690007318 (2)gb:AF534888_18096032e-57Catharanthus roseus type-A response regulator (RR1) mRNA, complete cds.685007318 (2)gb:AF534888_18096032e-57Catharanthus roseus type-A response regulator (RR1) mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF039M24+ GGGGCGACCGGAGAAAATCGCCGCCGTTGAT
JMSF039M24- GGGGCGACCGGAGAAAATCGCCGCCGTTGAT
                      ____________________________________________________________
consensus GGGGCGACCGGAGAAAATCGCCGCCGTTGAT
 
. : . : . : . : . : . :
rJMSF039M24+ GGTTGTTCTTCCACCTTTGGCGGCGGTGGGCGGGAGTTGCATGTCCTTGCCGTCGACGAT
JMSF039M24- GGTTGTTCTTCCACCTTTGGCGGCGGTGGGCGGGAGTTGCATGTCCTTGCCGTCGACGAT
                      ____________________________________________________________
consensus GGTTGTTCTTCCACCTTTGGCGGCGGTGGGCGGGAGTTGCATGTCCTTGCCGTCGACGAT
 
. : . : . : . : . : . :
rJMSF039M24+ AGCTACGTGGATAGGAAGGTCATTGAGAAGATGCTGAAGATTTCTTGCTGTAAAGTGACA
JMSF039M24- AGCTACGTGGATAGGAAGGTCATTGAGAAGATGCTGAAGATTTCTTGCTGTAAAGTGACA
                      ____________________________________________________________
consensus AGCTACGTGGATAGGAAGGTCATTGAGAAGATGCTGAAGATTTCTTGCTGTAAAGTGACA
 
. : . : . : . : . : . :
rJMSF039M24+ GCAGTAGATAGTGGAAGCAGGGCTCTGCAGTATCTGGGCTTGGATGGAGAGGAGAGCTCT
JMSF039M24- GCAGTAGATAGTGGAAGCAGGGCTCTGCAGTATCTGGGCTTGGATGGAGAGGAGAGCTCT
                      ____________________________________________________________
consensus GCAGTAGATAGTGGAAGCAGGGCTCTGCAGTATCTGGGCTTGGATGGAGAGGAGAGCTCT
 
. : . : . : . : . : . :
rJMSF039M24+ GCTGCAACTGATGGTCTGAAGGTGAATCTGATAATGACAGACTATTCAATGCCTGGGATG
JMSF039M24- GCTGCAACTGATGGTCTGAAGGTGAATCTGATAATGACAGACTATTCAATGCCTGGGATG
                      ____________________________________________________________
consensus GCTGCAACTGATGGTCTGAAGGTGAATCTGATAATGACAGACTATTCAATGCCTGGGATG
 
. : . : . : . : . : . :
rJMSF039M24+ ACAGGATATGAACTCCTTAAAAAGATTAAGGGTTCGTCGGCATTGAGGCAAATCCCCGTT
JMSF039M24- ACAGGATATGAACTCCTTAAAAAGATTAAGGGTTCGTCGGCATTGAGGCAAATCCCCGTT
                      ____________________________________________________________
consensus ACAGGATATGAACTCCTTAAAAAGATTAAGGGTTCGTCGGCATTGAGGCAAATCCCCGTT
 
. : . : . : . : . : . :
rJMSF039M24+ GTGATCATGTCATCCGAAAAGATTTTAGCCCGCATTGATAGTTGTCTGGAGGAAGGGGCT
JMSF039M24- GTGATCATGTCATCCGAAAAGATTTTAGCCCGCATTGATAGTTGTCTGGAGGAAGGGGCT
                      ____________________________________________________________
consensus GTGATCATGTCATCCGAAAAGATTTTAGCCCGCATTGATAGTTGTCTGGAGGAAGGGGCT
 
. : . : . : . : . : . :
rJMSF039M24+ AAAGAGTTTCTGATGAAGCCCGTTAAGCTGTCTGACGTGAAGCGTGTGGTAGATTTCATA
JMSF039M24- AAAGAGTTTCTGATGAAGCCCGTTAAGCTGTCTGACGTGAAGCGTGTGGTAGATTTCATA
                      ____________________________________________________________
consensus AAAGAGTTTCTGATGAAGCCCGTTAAGCTGTCTGACGTGAAGCGTGTGGTAGATTTCATA
 
. : . : . : . : . : . :
rJMSF039M24+ GTGAGAGGCGAGGAGGAGGATGGCAAAGAGACAGAAGAATCAACGACGGCTTCCTATTCA
JMSF039M24- GTGAGAGGCGAGGAGGAGGATGGCAAAGAGACAGAAGAATCAACGACGGCTTCCTATTCA
                      ____________________________________________________________
consensus GTGAGAGGCGAGGAGGAGGATGGCAAAGAGACAGAAGAATCAACGACGGCTTCCTATTCA
 
. : . : . : . : . : . :
rJMSF039M24+ TCAGCTCCTGATAACGACGGGTTGTATCTCGCTAACATTGCCACAATCTCTCTCGACGCA
JMSF039M24- TCAGCTCCTGATAACGACGGGTTGTATCTCGCTAACATTGCCACAATCTCTCTCGACGCA
                      ____________________________________________________________
consensus TCAGCTCCTGATAACGACGGGTTGTATCTCGCTAACATTGCCACAATCTCTCTCGACGCA
 
. : . : . : . : . : . :
rJMSF039M24+ TCCAAGAGAACATAGTTGCAGCTTTGGAGTTGTGTTTTGCTGAGATACTATTCTATAGTT
JMSF039M24- TCCAAGAGAACATAGTTGCAGCTTTGGAGTTGTGTTTTGCTGAGATACTATTCTATAGTT
                      ____________________________________________________________
consensus TCCAAGAGAACATAGTTGCAGCTTTGGAGTTGTGTTTTGCTGAGATACTATTCTATAGTT
 
. : . : . : . : . : . :
rJMSF039M24+ GCAANCTAGTTGTACATGCCTGGCTAGTAGAGAGGCTATATTCAACATACACCC
JMSF039M24- GCAA-CTAGTTGTACATGCCTGGCTAGTAAAGAGGCTATATTCAACATACACCCTTTGGA
                      ____________________________________________________________
consensus GCAANCTAGTTGTACATGCCTGGCTAGTAGAGAGGCTATATTCAACATACACCCTTTGGA