Previous Contig 007311:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFN016D15Sequence447007311 (5)sp|Q41914|LC70_ARATH1e-10Low-molecular-weight cysteine-rich protein LCR70 precursor.>pir|B84433|B84433 pr
JMSF039L19Sequence513007311 (5)sp|Q41914|LC70_ARATH2e-10Low-molecular-weight cysteine-rich protein LCR70 precursor.>pir|B84433|B84433 pr465007311 (5)sp|Q41914|LC70_ARATH1e-10Low-molecular-weight cysteine-rich protein LCR70 precursor.>pir|B84433|B84433 pr
JMSF048B07Sequence512007311 (5)sp|Q41914|LC70_ARATH2e-10Low-molecular-weight cysteine-rich protein LCR70 precursor.>pir|B84433|B84433 pr465007311 (5)sp|Q41914|LC70_ARATH1e-10Low-molecular-weight cysteine-rich protein LCR70 precursor.>pir|B84433|B84433 pr

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF048B07+ TTTTTTTTTTGGACGAAAACACAGAAATTGCAT
JMSF039L19+ TTTTTTTTTTAGAACGAAAACACAGAAATTGCAT
                      ____________________________________________________________
consensus TTTTTTTTTTTGGACGAAAACACAGAAATTGCAT
 
. : . : . : . : . : . :
JMSF048B07+ AACTTGAGACAAGAAAACGAAACACACAACATG-TTGACACATATATATATGTAATAACA
rJMSF048B07- AACGAAACACACAACATGGTTGACACATATATATATGTAATAACA
rJMSF039L19- AACGAAACACACAACATGNTTGACACATATATATATGTAATAACA
JMFN016D15+ AAACACACAACATG-TTGACACATATATATATGTAATAACA
JMSF039L19+ AACTTGAGACAAGAAAACGAAACACACAACATG-TTGACACATATATATATGTAATAACA
                      ____________________________________________________________
consensus AACTTGAGACAAGAAAACGAAACACACAACATGGTTGACACATATATATATGTAATAACA
 
. : . : . : . : . : . :
JMSF048B07+ ACCAAATCCAAACAACATGCATGCATGTTTGGATTATATTATTTGGGGGGGACATTTATT
rJMSF048B07- ACCAAATCCAAACAACATGCATGCATGTTTGGATTATATTATTTGGGGGGGACATTTATT
rJMSF039L19- ACCAAATCCAAACAACATGCATGCATGTTTGGATTATATTATTTGGGGGGGACATTTATT
JMFN016D15+ ACCAAATCCAAACAACATGCATGCATGTTTGGATTATATTATTTGGGGGGGACATTTATT
JMSF039L19+ ACCAAATCCAAACAACATGCATGCATGTTTGGATTATATTATTTGGGGGGGACATTTATT
                      ____________________________________________________________
consensus ACCAAATCCAAACAACATGCATGCATGTTTGGATTATATTATTTGGGGGGGACATTTATT
 
. : . : . : . : . : . :
JMSF048B07+ TATTTAGATATATATATATATAACAGTGATGGAATTGAAGTTGAAGCAAGCAATGTTGGT
rJMSF048B07- TATTTAGATATATATATATATAACAGTGATGGAATTGAAGTTGAAGCAAGCAATGTTGGT
rJMSF039L19- TATTTAGATATATATATATATAACAGTGATGGAATTGAAGTTGAAGCAAGCAATGTTGGT
JMFN016D15+ TATTTAGATATATATATATATAACAGTGATGGAATTGAAGTTGAAGCAAGCAATGTTGGT
JMSF039L19+ TATTTAGATATATATATATATAACAGTGATGGAATTGAAGTTGAAGCAAGCAATGTTGGT
                      ____________________________________________________________
consensus TATTTAGATATATATATATATAACAGTGATGGAATTGAAGTTGAAGCAAGCAATGTTGGT
 
. : . : . : . : . : . :
JMSF048B07+ TATTAGCAGCAAGGCTTGTTGCAGGTGCAGATGGGGTTGTAGGAACCGGTGCAGCTCCCA
rJMSF048B07- TATTAGCAGCAAGGCTTGTTGCAGGTGCAGATGGGGTTGTAGGAACCGGTGCAGCTCCCA
rJMSF039L19- TATTAGCAGCAAGGCTTGTTGCAGGTGCAGATGGGGTTGTAGGAACCGGTGCAGCTCCCA
JMFN016D15+ TATTAGCAGCAAGGCTTGTTGCAGGTGCAGATGGGGTTGTAGGAACCGGTGCAGCTCCCA
JMSF039L19+ TATTAGCAGCAAGGCTTGTTGCAGGTGCAGATGGGGTTGTAGGAACCGGTGCAGCTCCCA
                      ____________________________________________________________
consensus TATTAGCAGCAAGGCTTGTTGCAGGTGCAGATGGGGTTGTAGGAACCGGTGCAGCTCCCA
 
. : . : . : . : . : . :
JMSF048B07+ TTGGAAAACCCCTCAGACTTGCAAACTGTATTGCAGTTGCCGTTGGCAAAAATACATACC
rJMSF048B07- TTGGAAAACCCCTCAGACTTGCAAACTGTATTGCAGTTGCCGTTGGCAAAAATACATACC
rJMSF039L19- TTGGAAAACCCCTCAGACTTGCAAACTGTATTGCAGTTGCCGTTGGCAAAAATACATACC
JMFN016D15+ TTGGAAAACCCCTCAGACTTGCAAACTGTATTGCAGTTGCCGTTGGCAAAAATACATACC
JMSF039L19+ TTGGAAAACCCCTCAGACTTGCAAACTGTATTGCAGTTGCCGTTGGCAAAAATACATACC
                      ____________________________________________________________
consensus TTGGAAAACCCCTCAGACTTGCAAACTGTATTGCAGTTGCCGTTGGCAAAAATACATACC
 
. : . : . : . : . : . :
JMSF048B07+ CCTTTGAACGTTTGGCTCCGCGACGAGCACATTCTCGGACCCGCGGCCATTATTCCCATC
rJMSF048B07- CCTTTGAACGTTTGGCTCCGCGACGAGCACATTCTCGGACCCGCGGCCATTATTCCCATC
rJMSF039L19- CCTTTGAACGTTTGGCTCCGCGACGAGCACATTCTCGGACCCGCGGCCATTATTCCCATC
JMFN016D15+ CCTTTGAACGTTTGGCTCCGCGACGAGCACATTCTCGGACCCGCGGCCATTATTCCCATC
JMSF039L19+ CCTTTGAACGTTTGGCTCCGCGACGAGCACATTCTCGGACCCGCGGCCATTATTCCCATC
                      ____________________________________________________________
consensus CCTTTGAACGTTTGGCTCCGCGACGAGCACATTCTCGGACCCGCGGCCATTATTCCCATC
 
. : . : . : . : . : . :
JMSF048B07+ CCAGAGGCCATGAAGAGCATCACCAAGAGTGAGACAGTTGCAAACAAACGAACTGAAGAA
rJMSF048B07- CCAGAGGCCATGAAGAGCATCACCAAGAGTGAGACAGTTGCAAACAAACGAACTGAAGAA
rJMSF039L19- CCAGAGGCCATGAAGAGCATCACCAAGAGTGAGACAGTTGCAAACAAACGAACTGAAGAA
JMFN016D15+ CCAGAGGCCATGAAGAGCATCACCAAGAGTGAGACAGTTGCAAACAAACGAACTGAAGAA
JMSF039L19+ CCAGAGGCCATGAAGAGCATCACCAAGAGTGAGACAGTTGCAAACAAACGAACTGAAGAA
                      ____________________________________________________________
consensus CCAGAGGCCATGAAGAGCATCACCAAGAGTGAGACAGTTGCAAACAAACGAACTGAAGAA
 
. : . : . : . : . : . :
JMSF048B07+ GAAGCAGCCATCGTATATATGTAGTTGAGAACAAAAGAGGGTTGAAATGGGAATGCTG
rJMSF048B07- GAAGCAGCCATCGTATATATGTAGTTGAGAACAAAAGAGGGTTGAAATGGGAATGCTG
rJMSF039L19- GAAGCAGCCATCGTATATATGTAGTTGAGAACAAAAGAGGGTTGAAATGGGAATGCTG
JMFN016D15+ GAAGCAGCCATCGTATATATGTAGTTGAGAACAAAAGAGGGTTGAAA
JMSF039L19+ GAAGCAGCCATCGTATATATGTAGTTGAGAACAAAAGAGGGTTGAAATGGGAATGCTGTT
                      ____________________________________________________________
consensus GAAGCAGCCATCGTATATATGTAGTTGAGAACAAAAGAGGGTTGAAATGGGAATGCTGTT