Previous Contig 007310:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF039L10Sequence677007310 (3)pir|T46220|T462203e-65hypothetical protein T9C5.20 - Arabidopsis thaliana>gb:ATT10O8_1554290 Arabidops829007310 (3)pir|T46220|T462204e-65hypothetical protein T9C5.20 - Arabidopsis thaliana>gb:ATT10O8_1554290 Arabidops
JMSF051J09Sequence630008065 (2)gb:AK117129_18151762e-07Arabidopsis thaliana At1g55320 mRNA for putative acetyl-CoA synthetase, complete718007310 (3)gb:AC135563_17425856e-14Oryza sativa chromosome 3 BAC OSJNBb0015I02 genomic sequence, complete sequence.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF051J09+ GAGCTGAAGACAAAATTTTCNAGAGCCATACAGAGCAACCTT
                      ____________________________________________________________
consensus GAGCTGAAGACAAAATTTTCNAGAGCCATACAGAGCAACCTT
 
. : . : . : . : . : . :
rJMSF051J09+ AATCCTTTATTCAAGGTGAGTGCTGTAAAAATTGTTCCATCATTTNCACGAACAGCTTCA
                      ____________________________________________________________
consensus AATCCTTTATTCAAGGTGAGTGCTGTAAAAATTGTTCCATCATTTNCACGAACAGCTTCA
 
. : . : . : . : . : . :
rJMSF051J09+ AATAAGGTACTGAGGAGACTTTTAAGGGATAAATGGAAGCAGGAGCTTNTGACACAGAGT
                      ____________________________________________________________
consensus AATAAGGTACTGAGGAGACTTTTAAGGGATAAATGGAAGCAGGAGCTTNTGACACAGAGT
 
. : . : . : . : . : . :
rJMSF051J09+ AAACTTTAACTCACTATCTGGATGATGCAAGAGACATGGAGGCCAAAGTGCAGCAGCTTC
                      ____________________________________________________________
consensus AAACTTTAACTCACTATCTGGATGATGCAAGAGACATGGAGGCCAAAGTGCAGCAGCTTC
 
. : . : . : . : . : . :
rJMSF051J09+ ATCTTCAGAAACATAGAAGAGACTGAGATAATCTTTCCACTCAAAAGCCTTCTCTTCATG
                      ____________________________________________________________
consensus ATCTTCAGAAACATAGAAGAGACTGAGATAATCTTTCCACTCAAAAGCCTTCTCTTCATG
 
. : . : . : . : . : . :
rJMSF051J09+ GGGAGTAAAGCTTGTTCCAAACCGGACACAATTCGAGGCAGAGTACTCCTTCAGAGAAGG
rJMSF039L10- CAGAGAAGG
                      ____________________________________________________________
consensus GGGAGTAAAGCTTGTTCCAAACCGGACACAATTCGAGGCAGAGTACTCCTTCAGAGAAGG
 
. : . : . : . : . : . :
rJMSF051J09+ ATTACAAGTCAATCAAAAAATGGCTTATAGCAGGCTATGAATCTAAAGGTGAACTGCAGC
rJMSF039L10- ATTACAAGTCAATCAAAAAATGGCTTATAGCAGGCTATGAATCTAAAGGTGAACTGCAGC
                      ____________________________________________________________
consensus ATTACAAGTCAATCAAAAAATGGCTTATAGCAGGCTATGAATCTAAAGGTGAACTGCAGC
 
. : . : . : . : . : . :
rJMSF051J09+ AAGGCACTAAAATAGCCCGTGTGCCTATATTATCATCTAACAAGGCTATTACTGTCATCA
rJMSF039L10- AAGGCACTAAAATAGCCCGTGTGCCTATATTATCATCTAACAAGGCTATTACTGTCATCA
                      ____________________________________________________________
consensus AAGGCACTAAAATAGCCCGTGTGCCTATATTATCATCTAACAAGGCTATTACTGTCATCA
 
. : . : . : . : . : . :
rJMSF051J09+ ATCATCATTCTGTGGAGTGGAACACTTCAACACTGTATTTCGCAATCCTTAGTCCTTACA
rJMSF039L10- ATCATCATTCTGTGGAGTGGAACACTTCAACACTGTATTTCGCAATCCTTAGTCCTTACA
                      ____________________________________________________________
consensus ATCATCATTCTGTGGAGTGGAACACTTCAACACTGTATTTCGCAATCCTTAGTCCTTACA
 
. : . : . : . : . : . :
rJMSF051J09+ GTTAACCAAACACTTTGAGGCTGTATTTCACAAATCCTTATTGAAGTTATTATACTGGTA
rJMSF039L10- GTTAACCAAACACTTTGAGGCTGTATTTCACAAATCCTTATTGAAGTTATTATACTGGTA
JMSF039L10+ ATTATACTGGTA
                      ____________________________________________________________
consensus GTTAACCAAACACTTTGAGGCTGTATTTCACAAATCCTTATTGAAGTTATTATACTGGTA
 
. : . : . : . : . : . :
rJMSF051J09+ CTCGCTTTCCCCGGTAACGATCAAAGAAC
rJMSF039L10- CTCGCTTTCCCCGGTAACGATCAAAGAACGATCTGACAAAAGGCTGCTGAAAGAGCCAAC
JMSF039L10+ CTCGCTTTCCCCGGTAACGATCAAAGAACGATCTGACAAAAGGCTGCTGAAAGAGCCAAC
                      ____________________________________________________________
consensus CTCGCTTTCCCCGGTAACGATCAAAGAACGATCTGACAAAAGGCTGCTGAAAGAGCCAAC
 
. : . : . : . : . : . :
rJMSF039L10- CAACAATAGGAATCTTTTGCAGGAAAACTGCCAATGTTGGCCAGAACCCACTGAAAAGTA
JMSF039L10+ CAACAATAGGAATCTTTTGCAGGAAAACTGCCAATGTTGGCCAGAACCCACTGAAAAGTA
                      ____________________________________________________________
consensus CAACAATAGGAATCTTTTGCAGGAAAACTGCCAATGTTGGCCAGAACCCACTGAAAAGTA
 
. : . : . : . : . : . :
rJMSF039L10- CAACAAAGCCATAAGCCTCAAGAATCATCCCTATTATAGGCCATCCAATGACAACCAAGA
JMSF039L10+ CAACAAAGCCATAAGCCTCAAGAATCATCCCTATTATAGGCCATCCAATGACAACCAAGA
                      ____________________________________________________________
consensus CAACAAAGCCATAAGCCTCAAGAATCATCCCTATTATAGGCCATCCAATGACAACCAAGA
 
. : . : . : . : . : . :
rJMSF039L10- AAAAGCCAGCACCAAACGACATTGTTCCCTTATAGTTGCTACGTTTCATGAAGAACTGCA
JMSF039L10+ AAAAGCCAGCACCAAACGACATTGTTCCCTTATAGTTGCTACGTTTCATGAAGAACTGCA
                      ____________________________________________________________
consensus AAAAGCCAGCACCAAACGACATTGTTCCCTTATAGTTGCTACGTTTCATGAAGAACTGCA
 
. : . : . : . : . : . :
rJMSF039L10- TGGATGGCTTCAGACCAATAGTTAAGGCAACCCCTGATACGAAGAGGATATTTCCCATGG
JMSF039L10+ TGGATGGCTTCAGACCAATAGTTAAGGCAACCCCTGATACGAAGAGGATATTTCCCATGG
                      ____________________________________________________________
consensus TGGATGGCTTCAGACCAATAGTTAAGGCAACCCCTGATACGAAGAGGATATTTCCCATGG
 
. : . : . : . : . : . :
rJMSF039L10- CAATTAGCCCTTTGTCAAAGAAGAAAATGATTCCAATGAATGAAAATAACACTCCGAATC
JMSF039L10+ CAATTAGCCCTTTGTCAAAGAAGAAAATGATTCCAATGAATGAAAATAACACTCCGAATC
                      ____________________________________________________________
consensus CAATTAGCCCTTTGTCAAAGAAGAAAATGATTCCAATGAATGAAAATAACACTCCGAATC
 
. : . : . : . : . : . :
rJMSF039L10- CTGTCAAGCCTAACCCAATCTTTTTACGATCGTTCATCTCAAACGAAACCATTTTCGCGG
JMSF039L10+ CTGTCAAGCCTAACCCAATCTTTTTACGATCGTTCATCTCAAACGAAACCATTTTCGCGG
                      ____________________________________________________________
consensus CTGTCAAGCCTAACCCAATCTTTTTACGATCGTTCATCTCAAACGAAACCATTTTCGCGG
 
. : . : . : . : . : . :
rJMSF039L10- ATTCAGAT
JMSF039L10+ ATTCAGATTACCGTCAAACCGTAGACAAAACCTGCTATGCTGCTGTAGTGGTGGCGGAGC
                      ____________________________________________________________
consensus ATTCAGATTACCGTCAAACCGTAGACAAAACCTGCTATGCTGCTGTAGTGGTGGCGGAGC
 
. : . : . : . : . : . :
JMSF039L10+ TTATTGGCGAGGCTCGGAGTGGGGATTTTTATGGTTGTTATGGCGGATTACGGGATTTCC
                      ____________________________________________________________
consensus TTATTGGCGAGGCTCGGAGTGGGGATTTTTATGGTTGTTATGGCGGATTACGGGATTTCC