Previous Contig 007308:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS097C08Sequence617007308 (2)gb:AY140078_15825184e-20Arabidopsis thaliana unknown protein (At2g38420) mRNA, complete cds.>gb:BT008752
JMSF039L01Sequence697007308 (2)gb:AY140078_15825183e-27Arabidopsis thaliana unknown protein (At2g38420) mRNA, complete cds.>gb:BT008752876023866

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF039L01+ CAAAGAGCCCTAATCAACNACCCAAAAGTCGATCCAT
                      ____________________________________________________________
consensus CAAAGAGCCCTAATCAACNACCCAAAAGTCGATCCAT
 
. : . : . : . : . : . :
JMFS097C08+ GCACATTCCTAAGACCCC
JMSF039L01+ CTATCTGGATATTCATCAACTGACTCTTATTCAATATTTCAGGCACATTCCTAAGACCCC
                      ____________________________________________________________
consensus CTATCTGGATATTCATCAACTGACTCTTATTCAATATTTCAGGCACATTCCTAAGACCCC
 
. : . : . : . : . : . :
JMFS097C08+ ATTCACTCTTACAAAGAACAGAGAGCAGAGCATTCAAAGACTTCATAGTTGGGGCACATC
JMSF039L01+ ATTCACTCTTACAAAGAACAGAGAGCAGAGCATTCAAAGACTTCATAGTTGGGGCACATC
                      ____________________________________________________________
consensus ATTCACTCTTACAAAGAACAGAGAGCAGAGCATTCAAAGACTTCATAGTTGGGGCACATC
 
. : . : . : . : . : . :
JMFS097C08+ TAAACCTCGGAATCCCCAAGAACAGCTCAACCGCACATTGCAATTCACCAATATCACCAT
JMSF039L01+ TAAACCTCGGAATCCCCAAGAACAGCTCAACCGCACATTGCAATTCACCAATATCACCAT
                      ____________________________________________________________
consensus TAAACCTCGGAATCCCCAAGAACAGCTCAACCGCACATTGCAATTCACCAATATCACCAT
 
. : . : . : . : . : . :
JMFS097C08+ AAAACTTGATGAGATAAAAAAAAACACCCTCGGGTATCTCAAAGTTGTCAACTTTCTGCA
JMSF039L01+ AAAACTTGATGAGATAAACAAAAACACCCTCGGGTATCTCAAAGTTGTCAACTTTCTGCA
                      ____________________________________________________________
consensus AAAACTTGATGAGATAAACAAAAACACCCTCGGGTATCTCAAAGTTGTCAACTTTCTGCA
 
. : . : . : . : . : . :
JMFS097C08+ AATGATCAAGAACTTTATGGATCAAATCATAGGTACAAGGGTCTCTGGTAATTTCCTTGA
JMSF039L01+ AATGATCAAGAACTTTATGGATCAAATCATAGGTACAAGGGTCTCTGGTAATTTCCTTGA
                      ____________________________________________________________
consensus AATGATCAAGAACTTTATGGATCAAATCATAGGTACAAGGGTCTCTGGTAATTTCCTTGA
 
. : . : . : . : . : . :
JMFS097C08+ TTACGAATTGGTAAGCACTTGGAGTGGGGTCGCATTGGTAATCCGCGAATGAATCGATGA
JMSF039L01+ TTACGAATTGGTAAGCACTTGGAGTGGGGTCGCATTGGTAATCCGCGAATGAATCGATGA
                      ____________________________________________________________
consensus TTACGAATTGGTAAGCACTTGGAGTGGGGTCGCATTGGTAATCCGCGAATGAATCGATGA
 
. : . : . : . : . : . :
JMFS097C08+ GGGCCGATAAAGGATTCGACGTTGAAACCCTTTCTATCATGCTCTGCATAGCTAGCTGAT
JMSF039L01+ GGGCCGATAAAGGATTCGACGTTGAAACCCTTTCTATCATGCTCTGCATAGCTAGCTGAT
                      ____________________________________________________________
consensus GGGCCGATAAAGGATTCGACGTTGAAACCCTTTCTATCATGCTCTGCATAGCTAGCTGAT
 
. : . : . : . : . : . :
JMFS097C08+ GGCCGAAGCTCTCGTGCCACTTGGTTTTGTACGGCGATATCGGCCATTTTCTTCTTTTTC
JMSF039L01+ GGCCGAAGCTCTCGTGCCACTTGGTTTTGTACGGCGATATCGGCCATTTTCTTCTTTTTC
                      ____________________________________________________________
consensus GGCCGAAGCTCTCGTGCCACTTGGTTTTGTACGGCGATATCGGCCATTTTCTTCTTTTTC
 
. : . : . : . : . : . :
JMFS097C08+ TCAAGTAGTAGTTTTTCAATTTGGGTTTTGAAGAAGACGAAAATGAAAAGGACGAAAGAT
JMSF039L01+ TCAAGTAGTAGTTTTTCAATTTGGGTTTTGAAGAAGACGAAAATGAAAAGGACGAAAGAT
                      ____________________________________________________________
consensus TCAAGTAGTAGTTTTTCAATTTGGGTTTTGAAGAAGACGAAAATGAAAAGGACGAAAGAT
 
. : . : . : . : . : . :
JMFS097C08+ TTGTTCTCAGCTGCCAGATTGGTAGCCTGCAGCTCCTTAACATCTTCCAGAGAATCTAAA
JMSF039L01+ TTGTTCTCAGCTGCCAGATTGGTAGCCTGCAGCTCCTTAACATCTTCCAGAGAATCTAAA
                      ____________________________________________________________
consensus TTGTTCTCAGCTGCCAGATTGGTAGCCTGCAGCTCCTTAACATCTTCCAGAGAATCTAAA
 
. : . : . : . : . : . :
JMFS097C08+ AGGTTTGAGCGGAGAGAATCGTAGGATCATAGTACAGTACTCCACGATCTCCCAACTC
JMSF039L01+ AGGTTTGAGCGGAGAGAATCGTAGGATCATAGTACAGTACTCCACGATCTCCCAACTCCA
                      ____________________________________________________________
consensus AGGTTTGAGCGGAGAGAATCGTAGGATCATAGTACAGTACTCCACGATCTCCCAACTCCA