Previous Contig 007307:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF038N11Sequence622007307 (2)gb:AY087994_15730183e-62Arabidopsis thaliana clone 40229 mRNA, complete sequence.764010015 (2)gb:AB118014_15278180.021Oryza sativa (japonica cultivar-group) bip127 mRNA for BRI1-KD interacting prote
JMSF039K22Sequence571007307 (2)gb:AY087994_15730181e-50Arabidopsis thaliana clone 40229 mRNA, complete sequence.858010015 (2)gb:AB118014_15278187e-13Oryza sativa (japonica cultivar-group) bip127 mRNA for BRI1-KD interacting prote

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF038N11+ GCAGAAAGTAGCCTTTTAAAATTGGGAGGTGCCCAGTATTGATCCTC
                      ____________________________________________________________
consensus GCAGAAAGTAGCCTTTTAAAATTGGGAGGTGCCCAGTATTGATCCTC
 
. : . : . : . : . : . :
JMFF038N11+ TATGTATGCAGCAATAGTTTTCTTGTTTGATCCACCAGGCTCCTTCAAGTTGTTTATAGC
JMSF039K22+ ATCCACCAGGCTCCTTCAAGTTGTTTATAGC
                      ____________________________________________________________
consensus TATGTATGCAGCAATAGTTTTCTTGTTTGATCCACCAGGCTCCTTCAAGTTGTTTATAGC
 
. : . : . : . : . : . :
JMFF038N11+ ATCCATAACAAGATTGTCCAACCGTATGATGGATCTCTTTGAGCCACCATTCTGTGGAGA
JMSF039K22+ ATCCATAACAAGATTGTCCAACCGTATGATGGATCTCTTTGAGCCACCATTCTGTGGAGA
                      ____________________________________________________________
consensus ATCCATAACAAGATTGTCCAACCGTATGATGGATCTCTTTGAGCCACCATTCTGTGGAGA
 
. : . : . : . : . : . :
JMFF038N11+ ACCACTAGAAGTTTCAACTCTCTTGCCTTCACTACTTTCCTCCTCGCTTTGAACTACATT
JMSF039K22+ ACCACTAGAAGTTTCAACTCTCTTGCCTTCACTACTTTCCTCCTCGCTTTGAACTACATT
                      ____________________________________________________________
consensus ACCACTAGAAGTTTCAACTCTCTTGCCTTCACTACTTTCCTCCTCGCTTTGAACTACATT
 
. : . : . : . : . : . :
JMFF038N11+ TGTAAGAGCCAATGAGTTCTCATCCTGTTTAGAGGTTCGGTGCATCCTTTTAACTGCTAA
JMSF039K22+ TGTAAGAGCCAATGAGTTCTCATCCTGTTTAGAGGTTCGGTGCATCCTTTTAACTGCTAA
                      ____________________________________________________________
consensus TGTAAGAGCCAATGAGTTCTCATCCTGTTTAGAGGTTCGGTGCATCCTTTTAACTGCTAA
 
. : . : . : . : . : . :
JMFF038N11+ TCTTGACTTCTCTCGAGATCCCCAGCCATTTGCCATCACAGTCATGTTTCTCCACTTGTC
JMSF039K22+ TCTTGACTTCTCTCGAGATCCCCAGCCATTTGCCATCACAGTCATGTTTCTCCACTTGTC
                      ____________________________________________________________
consensus TCTTGACTTCTCTCGAGATCCCCAGCCATTTGCCATCACAGTCATGTTTCTCCACTTGTC
 
. : . : . : . : . : . :
JMFF038N11+ CTTGAGATCTACATTTGAACGAAGATACAATACTCCACTATATTCTGGATCCTTAAGGAT
JMSF039K22+ CTTGAGATCTACATTTGAACGAAGATACAATACTCCACTATATTCTGGATCCTTAAGGAT
                      ____________________________________________________________
consensus CTTGAGATCTACATTTGAACGAAGATACAATACTCCACTATATTCTGGATCCTTAAGGAT
 
. : . : . : . : . : . :
JMFF038N11+ CGTGCGCCATTTGCCTGGTCCATGCTTGAGTACTCCAGCTTTAAGAGCAGCTTCTTCTTC
JMSF039K22+ CGTGCGCCATTTGCCTGGTCCATGCTTGAGTACTCCAGCTTTAAGAGCAGCTTCTTCTTC
                      ____________________________________________________________
consensus CGTGCGCCATTTGCCTGGTCCATGCTTGAGTACTCCAGCTTTAAGAGCAGCTTCTTCTTC
 
. : . : . : . : . : . :
JMFF038N11+ AGAAGTCCATTTTTGTTTAGGTGCACCCATTAAAGGTTTTTATGGAAAGAGGTC
JMSF039K22+ AGAAGTCCATTTTTGTTTAGGTGCACCCATTAAAGGTTTTTATGGAAAGAGGTCTTAAGG
                      ____________________________________________________________
consensus AGAAGTCCATTTTTGTTTAGGTGCACCCATTAAAGGTTTTTATGGAAAGAGGTCTTAAGG
 
. : . : . : . : . : . :
JMSF039K22+ GAGACGAAGGACAAAGATAATTAGAAATGGGAGAGTTATCCAGAAAAGTCGTTCAGATGT
                      ____________________________________________________________
consensus GAGACGAAGGACAAAGATAATTAGAAATGGGAGAGTTATCCAGAAAAGTCGTTCAGATGT
 
. : . : . : . : . : . :
JMSF039K22+ AGCGATTGATGCTCAGAGCTTTCAGAATTTGGACGTGCCCTGTCTGAACTCTGAAGTCTC
                      ____________________________________________________________
consensus AGCGATTGATGCTCAGAGCTTTCAGAATTTGGACGTGCCCTGTCTGAACTCTGAAGTCTC