Previous Contig 007304:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF016N20Sequence521007304 (7)gb:QRO298245_17032042e-23Quercus robur mRNA for geranyl diphosphat synthase (gppS gene).739008976 (8)gb:QRO298245_17032042e-78Quercus robur mRNA for geranyl diphosphat synthase (gppS gene).
JMFF017I20Sequence580007304 (7)gb:QRO298245_17032045e-23Quercus robur mRNA for geranyl diphosphat synthase (gppS gene).633008976 (8)gb:QRO298245_17032042e-57Quercus robur mRNA for geranyl diphosphat synthase (gppS gene).
JMFF043N16Sequence637007304 (7)gb:QRO298245_17032042e-31Quercus robur mRNA for geranyl diphosphat synthase (gppS gene).569008976 (8)gb:QRO298245_17032041e-58Quercus robur mRNA for geranyl diphosphat synthase (gppS gene).
JMFF051M21Sequence645007304 (7)gb:QRO298245_17032047e-32Quercus robur mRNA for geranyl diphosphat synthase (gppS gene).610008976 (8)gb:QRO298245_17032049e-58Quercus robur mRNA for geranyl diphosphat synthase (gppS gene).
JMSF022F23Sequence692007304 (7)gb:AY166797_15862292e-11Citrus unshiu geranylgeranyl diphosphate synthase (Ggps) mRNA, complete cds.758008976 (8)gb:QRO298245_17032042e-84Quercus robur mRNA for geranyl diphosphat synthase (gppS gene).
JMSF024H08Sequence652007304 (7)gb:AY166797_15862293e-05Citrus unshiu geranylgeranyl diphosphate synthase (Ggps) mRNA, complete cds.495008502 (5)gb:YSAQLAG_17281552e-41C.maltosa ribosomal protein L41 (LEL41) gene, complete cds.
JMSF039K08Sequence673007304 (7)gb:AY166797_15862294e-07Citrus unshiu geranylgeranyl diphosphate synthase (Ggps) mRNA, complete cds.744008976 (8)gb:QRO298245_17032048e-78Quercus robur mRNA for geranyl diphosphat synthase (gppS gene).

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF016N20+ TTCTAAAGAAATACTCAGAAGCTGAAGCAAGCTTTGGCACCTCTGCTATTA
JMFF017I20+ CTAAAGAAATACTCAGAAGCTGAAGCAAGCTTTGGCACCTCTGCTATTA
                      ____________________________________________________________
consensus TTCTAAAGAAATACTCAGAAGCTGAAGCAAGCTTTGGCACCTCTGCTATTA
 
. : . : . : . : . : . :
JMFF016N20+ CCATTGCCCTCAGCTTGTTTGCCACAAGTGATAATTCATCAGCAACAAGTGAAAATGGAT
JMFF017I20+ CCATTGCCCTCAGCTTGTTTGCCACAAGTGATAATTCATCAGCAACAAGTGAAAATGGAT
JMSF022F23+ ACAAGTGATAATTCATCAGCAACAAGTGAAAATGGAT
JMSF039K08+ AGTGAAAATGGAT
                      ____________________________________________________________
consensus CCATTGCCCTCAGCTTGTTTGCCACAAGTGATAATTCATCAGCAACAAGTGAAAATGGAT
 
. : . : . : . : . : . :
JMFF016N20+ CCAATTGCTCCTCGGCTACAGCACTGCTTTGGTGATGAACCTGCTGACCGATACTCTTCA
JMFF017I20+ CCAATTGCTCCTCGGCTACAGCACTGCTTTGGTGATGAACCTGCTGACCGATACTCTTCA
JMFF051M21+ CCTCGGCTACAGCACTGCTTTGGTGATGAACCTGCTGACCGATACTCTTCA
JMFF043N16+ CCTCGGCTACAGCACTGCTTTGGTGATGAACCTGCTGACCGATACTCTTCA
JMSF024H08+ CCTCGGCTACAGCACTGCTTTGGTGATGAACCTGCTGACCGATACTCTTCA
JMSF022F23+ CCAATTGCTCCTCGGCTACAGCACTGCTTTGGTGATGAACCTGCTGACCGATACTCTTCA
JMSF039K08+ CCAATTGCTCNTCGGCTACAGCACTGCTTTGGTGATGAACCTGCTGACCGATACTCTTCA
                      ____________________________________________________________
consensus CCAATTGCTCCTCGGCTACAGCACTGCTTTGGTGATGAACCTGCTGACCGATACTCTTCA
 
. : . : . : . : . : . :
JMFF016N20+ CAGCATTAGACACCCAATAATAAATTGCTCTCCTACCCAAAACCTGTTGGGAAGCGTCAA
JMFF017I20+ CAGCATTAGACACCCAATAATAAATTGCTCTCCTACCCAAAACCTGTTGGGAAGCGTCAA
JMFF051M21+ CAGCATTAGACACCCAATAATAAATTGCTCTCCTACCCAAAACCTGTTGGGAAGCGTCAA
JMFF043N16+ CAGCATTAGACACCCAATAATAAATTGCTCTCCTACCCAAAACCTGTTGGGAAGCGTCAA
JMSF024H08+ CAGCATTAGACACCCAATAATAAATTGCTCTCCTACCCAAAACCTGTTGGGAAGCGTCAA
JMSF022F23+ CAGCATTAGACACCCAATAATAAATTGCTCTCCTACCCAAAACCTGTTGGGAAGCGTCAA
JMSF039K08+ CAGCATTAGACACCCAATAATAAATTGCTCTCCTACCCAAAACCTGTTGGGAAGCGTCAA
                      ____________________________________________________________
consensus CAGCATTAGACACCCAATAATAAATTGCTCTCCTACCCAAAACCTGTTGGGAAGCGTCAA
 
. : . : . : . : . : . :
JMFF016N20+ AGGGGGCGGGGAAGATAGAGGAATTTGTAGGGGAAAACAAGTGATGTCGGTGATGCTGCT
JMFF017I20+ AGGGGGCGGGGAAGATAGAGGAATTTGTAGGGGAAAACAAGTGATGTCGGTGATGCTGCT
JMFF051M21+ AGGGGGCGGGGAAGATAGAGGAATTTGTAGGGGAAAACAAGTGATGTCGGTGATGCTGCT
JMFF043N16+ AGGGGGCGGGGAAGATAGAGGAATTTGTAGGGGAAAACAAGTGATGTCGGTGATGCTGCT
JMSF024H08+ AGGGGGCGGGGAAGATAGAGGAATTTGTAGGGGAAAACAAGTGATGTCGGTGATGCTGCT
JMSF022F23+ AGGGGGCGGGGAAGATAGAGGAATTTGTAGGGGAAAACAAGTGATGTCGGTGATGCTGCT
JMSF039K08+ AGGGGGCGGGGAAGATAGAGGAATTTGTAGGGGAAAACAAGTGATGTCGGTGATGCTGCT
                      ____________________________________________________________
consensus AGGGGGCGGGGAAGATAGAGGAATTTGTAGGGGAAAACAAGTGATGTCGGTGATGCTGCT
 
. : . : . : . : . : . :
JMFF016N20+ GCTGCTCAACGGGCAAGGATAATAGCCATCTAAATCTATTGAAATTGCCTCTGGAAATCC
JMFF017I20+ GCTGCTCAACGGGCAAGGATAATAGCCATCTAAATCTATTGAAATTGCCTCTGGAAATCC
JMFF051M21+ GCTGCTCAACGGGCAAGGATAATAGCCATCTAAATCTATTGAAATTGCCTCTGGAAATCC
JMFF043N16+ GCTGCTCAACGGGCAAGGATAATAGCCATCTAAATCTATTGAAATTGCCTCTGGAAATCC
JMSF024H08+ GCTGCTCAACGGGCAAGGATAATAGCCATCTAAATCTATTGAAATTGCCTCTGGAAATCC
JMSF022F23+ GCTGCTCAACGGGCAAGGATAATAGCCATCTAAATCTATTGAAATTGCCTCTGGAAATCC
JMSF039K08+ GCTACTCAACGGGCAAGGATAATAGCCATCTAAATCTATTGAAATTGCCTCTGGAAATCC
                      ____________________________________________________________
consensus GCTGCTCAACGGGCAAGGATAATAGCCATCTAAATCTATTGAAATTGCCTCTGGAAATCC
 
. : . : . : . : . : . :
JMFF016N20+ GAGATAGTTCTCTTGAGAGTAACATATCTTCTTCTTCTTCTCCTCCTTTTGCTTCTTATT
JMFF017I20+ GAGATAGTTCTCTTGAGAGTAACATATCTTCTTCTTCTTCTCCTCCTTTTGCTTCTTATT
JMFF051M21+ GAGATAGTTCTCTTGAGAGTAACATATCTTCTTCTTCTTCTCCTCCTTTTGCTTCTTATT
JMFF043N16+ GAGATAGTTCTCTTGAGAGTAACATATCTTCTTCTTCTTCTCCTCCTTTTGCTTCTTATT
JMSF024H08+ GAGATAGTTCTCTTGAGAGTAACATATCTTCTTCTTCTTCTCCTCCTTTTGCTTCTTATT
JMSF022F23+ GAGATAGTTCTCTTGAGAGTAACATATCTTCTTCTTCTTCTCCTCCTTTTGCTTCTTATT
JMSF039K08+ GAGATAGTTCTCTTGAGAGTAACATATCTTCTTCTTCTTCTCCTCCTTTTGCTTCTTATT
                      ____________________________________________________________
consensus GAGATAGTTCTCTTGAGAGTAACATATCTTCTTCTTCTTCTCCTCCTTTTGCTTCTTATT
 
. : . : . : . : . : . :
JMFF016N20+ CTTCTTCTTAGATGTGTAATATACGTATATGTGCGAGCGAGAGAGGGAGGGCTTAGGGCG
JMFF017I20+ CTTCTTCTTAGATGTGTAATATACGTATATGTGCGAGCGAGAGAGGGAGGGCTTAGGGCG
JMFF051M21+ CTTCTTCTTAGATGTGTAATATACGTATATGTGCGAGCGAGAGAGGGAGGGCTTAGGGCG
JMFF043N16+ CTTCTTCTTAGATGTGTAATATACGTATATGTGCGAGCGAGAGAGGGAGGGCTTAGGGCG
JMSF024H08+ CTTCTTCTTAGATGTGTAATATACGTATATGTGCGAGCGAGAGAGGGAGGGCTTAGGGCG
JMSF022F23+ CTTCTTCTTAGATGTGTAATATACGTATATGTGCGAGCGAGAGAGGGAGGGCTTAGGGCG
JMSF039K08+ CTTCTTCTTAGATGTGTAATATACGTATATGTGCGAGCGAGAGAGGGAGGGCTTAGGGCG
                      ____________________________________________________________
consensus CTTCTTCTTAGATGTGTAATATACGTATATGTGCGAGCGAGAGAGGGAGGGCTTAGGGCG
 
. : . : . : . : . : . :
JMFF016N20+ GCGGTTGAGTCAAAGTAAGGGAGAAGAAGATTAATAGTGATGATTAAAGC
JMFF017I20+ GCGGTTGAGTCAAAGTAAGGGAGAAGAAGATTAATAGTGATGATTAAAGCGGCGGGCGGC
JMFF051M21+ GCGGTTGAGTCAAAGTAAGGGAGAAGAAGATTAATAGTGATGATTAAAGCGGCGGGCGGC
JMFF043N16+ GCGGTTGAGTCAAAGTAAGGGAGAAGAAGATTAATAGTGATGATTAAAGCGGCGGGCGGC
JMSF024H08+ GCGGTTGAGTCAAAGTAAGGGAGAAGAAGATTAATAGTGATGATTAAAGCGGCGGGCGGC
JMSF022F23+ GCGGTTGAGTCAAAGTAAGGGAGAAGAAGATTAATAGTGATGATTAAAGCGGCGGGCGGC
JMSF039K08+ GCGGTTGAGTCAAAGTAAGGGAGAAGAAGATTAATAGTGATGATTAAAGCGGCGGGCGGC
                      ____________________________________________________________
consensus GCGGTTGAGTCAAAGTAAGGGAGAAGAAGATTAATAGTGATGATTAAAGCGGCGGGCGGC
 
. : . : . : . : . : . :
JMFF017I20+ AGGGAGATGAGTTTGGTTTAGAAAATGCAGTTGAATGACGAAGCCAATTCT
JMFF051M21+ AGGGAGATGAGTTTGGTTTAGAAAATGCAGTTGAATGACGAAGCCAATTCTGGACCTT
JMFF043N16+ AGGGAGATGAGTTTGGTTTAGAAAATGCAGTTGAATGACGAAGCCAATTCTGGACCTT
JMSF024H08+ AGGGAGATGAGTTTGGTTTAGAAAATGCAGTTGAATGACGAAGCCAATTCT
JMSF022F23+ AGGGAGATGAGTTTGGTTTAGAAAATGCAGTTGAATGACGAAGCCAATTCTGGACCTTAC
JMSF039K08+ AGGGAGATGAGTTTGGTTTAGAAAATGCAGTTGAATGACGAAGCCAATTCTGGACCTTAC
                      ____________________________________________________________
consensus AGGGAGATGAGTTTGGTTTAGAAAATGCAGTTGAATGACGAAGCCAATTCTGGACCTTAC
 
. : . : . : . : . : . :
JMSF022F23+ GTCCAAACCAAATGCCCCTTTCGCAAGAAAAATTGAGCCGCGTGTACGGGAAGGCGGCGG
JMSF039K08+ GTCCAAACCAAATGCCCCTTTCGCAAGAAAAATTGAGCCGCGTGTACGGGAAGGCGGCGG
                      ____________________________________________________________
consensus GTCCAAACCAAATGCCCCTTTCGCAAGAAAAATTGAGCCGCGTGTACGGGAAGGCGGCGG
 
. : . : . : . : . : . :
JMSF022F23+ CGGCGAGGGAAATGGCCAAGCAGATCTTGGTGGCTTGGTCTTTAGGGAAGCATGGCGCGT
JMSF039K08+ CGGCGAGGGAAATGGCCAAGCAGATCTTGGTGGCTTGGTCTTTAGGGAAGCATGGCGCGT
                      ____________________________________________________________
consensus CGGCGAGGGAAATGGCCAAGCAGATCTTGGTGGCTTGGTCTTTAGGGAAGCATGGCGCGT
 
. : . : . : . : . : . :
JMSF022F23+ TGTAGGCTCCTGCAAATCTGGAACTAAAACCGGTGGGTGGGTTGCACCTGGT
JMSF039K08+ TGTAGGCTCCTGCAAATCTGGAACTAAAACCGGTGGGTGGGTTGCACCTGGTTCGAACCC
                      ____________________________________________________________
consensus TGTAGGCTCCTGCAAATCTGGAACTAAAACCGGTGGGTGGGTTGCACCTGGTTCGAACCC