Previous Contig 007303:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF039K03Sequence684007303 (2)gb:AY342007_16008131e-62Capsicum annuum alanine aminotransferase (AlaAT) mRNA, complete cds.
JMSF044P05Sequence691007303 (2)gb:AY342007_1600813e-103Capsicum annuum alanine aminotransferase (AlaAT) mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF044P05+ TCTGAGATCTCAAGTCCCCATCCAGTTGCCTCGTCAAGGTAATAAGGAACAAGA
                      ____________________________________________________________
consensus TCTGAGATCTCAAGTCCCCATCCAGTTGCCTCGTCAAGGTAATAAGGAACAAGA
 
. : . : . : . : . : . :
JMSF044P05+ GTGCCACCATGGAGAGCAATTGAAGCAGAGTAAAGTGGATACTGAGGGATGGGACAAAGA
                      ____________________________________________________________
consensus GTGCCACCATGGAGAGCAATTGAAGCAGAGTAAAGTGGATACTGAGGGATGGGACAAAGA
 
. : . : . : . : . : . :
JMSF044P05+ ATTCCATCATTCTCTGAACTAATCAACAGCTGCATCATCATGTGAACCGCTGGGCTTGCA
                      ____________________________________________________________
consensus ATTCCATCATTCTCTGAACTAATCAACAGCTGCATCATCATGTGAACCGCTGGGCTTGCA
 
. : . : . : . : . : . :
JMSF044P05+ CCATCAGTCAAGAAAATGTCATTTGGATTGGCAGGGAAACCATCACGAGCTTCTATACCA
JMSF039K03+ AAACCATCACGAGCTTCTATACCA
                      ____________________________________________________________
consensus CCATCAGTCAAGAAAATGTCATTTGGATTGGCAGGGAAACCATCACGAGCTTCTATACCA
 
. : . : . : . : . : . :
JMSF044P05+ GAAGCAATTGTATCACGCAATCCTTTGATACCCTGACTATGGCTGTATGCACCAGTTGCT
JMSF039K03+ GAAGCAATTGTATCACGCAATCCTTTGATACCCTGACTATGGCTGTATGCACCAGTTGCT
                      ____________________________________________________________
consensus GAAGCAATTGTATCACGCAATCCTTTGATACCCTGACTATGGCTGTATGCACCAGTTGCT
 
. : . : . : . : . : . :
JMSF044P05+ CTTCCTGGAATTTGATCAAGAATCTGGAAAGCTCGCTCTATGGAGTCCGCACTGAACAGG
JMSF039K03+ CTTCCTGGAATTTGATCAAGAATCTGGAAAGCTCGCTCTATGGAGTCCGCACTGAACAGG
                      ____________________________________________________________
consensus CTTCCTGGAATTTGATCAAGAATCTGGAAAGCTCGCTCTATGGAGTCCGCACTGAACAGG
 
. : . : . : . : . : . :
JMSF044P05+ CCTTGAGTTTCACTTTTATCCAAAATGGAAGGATGGTCACATAATGCAAGCACCTCCCTA
JMSF039K03+ CCTTGAGTTTCACTTTTATCCAAAATGGAAGGATGGTCACATAATGCAAGCACCTCCCTA
                      ____________________________________________________________
consensus CCTTGAGTTTCACTTTTATCCAAAATGGAAGGATGGTCACATAATGCAAGCACCTCCCTA
 
. : . : . : . : . : . :
JMSF044P05+ AAGAAAGTAATTGGCTGCTGACCAAGGGATTGAGGGTTTCCAATATTGCAATAAATTATC
JMSF039K03+ AAGAAAGTAATTGGCTGCTGACCAAGGGATTGAGGGTTTCCAATATTGCAATAAATTATC
                      ____________________________________________________________
consensus AAGAAAGTAATTGGCTGCTGACCAAGGGATTGAGGGTTTCCAATATTGCAATAAATTATC
 
. : . : . : . : . : . :
JMSF044P05+ TCATCAAATGGGTGAGAACCTGGTTTTGCCTGTAACTCTTCTTGTATTTTCTGAGCAAGG
JMSF039K03+ TCATCAAATGGGTGAGAACCTGGTTTTGCCTGTAACTCTTCTTGTATTTTCTGAGCAAGG
                      ____________________________________________________________
consensus TCATCAAATGGGTGAGAACCTGGTTTTGCCTGTAACTCTTCTTGTATTTTCTGAGCAAGG
 
. : . : . : . : . : . :
JMSF044P05+ TTGACAATTTCACCACGAACAGCATACTCGCATTTCAGAACCTTGGGATTGATGGATTGA
JMSF039K03+ TTGACAATTTCACCACGAACAGCATACTCGCATTTCAGAACCTTGGGATTGATGGATTGA
                      ____________________________________________________________
consensus TTGACAATTTCACCACGAACAGCATACTCGCATTTCAGAACCTTGGGATTGATGGATTGA
 
. : . : . : . : . : . :
JMSF044P05+ AGAGTGAGGGGAGTGGACGAATAATCAGAACCCGCCATTGAATCGGAGGAAGGAGAGGGA
JMSF039K03+ AGAGTGAGGGGAGTGGACGAATAATCAGAACCCGCCATTGAATCGGAGGAAGGAGAGGGA
                      ____________________________________________________________
consensus AGAGTGAGGGGAGTGGACGAATAATCAGAACCCGCCATTGAATCGGAGGAAGGAGAGGGA
 
. : . : . : . : . : . :
JMSF044P05+ AGGGGAGTCGTACTAGTACCGCTGAGGAAACGCAAC
JMSF039K03+ AGGGGAGTCGTACTAGTACCGCTGAGGAAACGCAACGGAGACGAAGTGCGACGCGGAAAC
                      ____________________________________________________________
consensus AGGGGAGTCGTACTAGTACCGCTGAGGAAACGCAACGGAGACGAAGTGCGACGCGGAAAC
 
. : . : . : . : . : . :
JMSF039K03+ ACGGAAGAAGGAGGATAAGAGACGGCTTGCGCAACAAGGTTTCTAGCTTTTTCGGCCACG
                      ____________________________________________________________
consensus ACGGAAGAAGGAGGATAAGAGACGGCTTGCGCAACAAGGTTTCTAGCTTTTTCGGCCACG
 
. : . : . : . : . : . :
JMSF039K03+ AATCTCCGCATTGTGAAAATCTCCGTTCACCCCTTACCCAAATATAAAGACGTGGTGGGC
                      ____________________________________________________________
consensus AATCTCCGCATTGTGAAAATCTCCGTTCACCCCTTACCCAAATATAAAGACGTGGTGGGC
 
. : . : . : . : . : . :
JMSF039K03+ AAGTAGCGTAGCCAACCCCTACAAACCTTTGACTCGCAGAACTTTCTGCCCAGCTGCCCA
                      ____________________________________________________________
consensus AAGTAGCGTAGCCAACCCCTACAAACCTTTGACTCGCAGAACTTTCTGCCCAGCTGCCCA