Previous Contig 007302:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF025A23Sequence754007302 (13)gb:AB126259_15282624e-91Nicotiana tabacum mRNA for aspartate aminotransferase, partial cds.
JMFF030O10Sequence515001513 (11)gb:CLU89494_16479119e-24Canavalia lineata aspartate aminotransferase 2 precursor (AAT2) mRNA, complete c693007302 (13)gb:AB126259_15282622e-83Nicotiana tabacum mRNA for aspartate aminotransferase, partial cds.
JMFF031H09Sequence562001513 (11)gb:CLU89494_16479112e-32Canavalia lineata aspartate aminotransferase 2 precursor (AAT2) mRNA, complete c767007302 (13)gb:AB126259_15282624e-94Nicotiana tabacum mRNA for aspartate aminotransferase, partial cds.
JMFF043O07Sequence643001513 (11)gb:CLU89494_16479115e-40Canavalia lineata aspartate aminotransferase 2 precursor (AAT2) mRNA, complete c607007302 (13)gb:AB126259_15282621e-63Nicotiana tabacum mRNA for aspartate aminotransferase, partial cds.
JMSF004N05Sequence398004645 (2)sp|P41153|HSF8_LYCPE3e-28Heat shock factor protein HSF8 (Heat shock transcription factor 8) (HSTF 8) (Hea284007302 (13)gb:AB126259_15282629e-15Nicotiana tabacum mRNA for aspartate aminotransferase, partial cds.
JMSF005C21Sequence388001513 (11)pir|S22465|XNYLB7e-08aspartate transaminase (EC 2.6.1.1) precursor - narrow-leaved blue lupine (fragm463007302 (13)gb:AB126259_15282621e-47Nicotiana tabacum mRNA for aspartate aminotransferase, partial cds.
JMSF006H18Sequence401018478pir|E84651|E846510.006hypothetical protein At2g25690 [imported] - Arabidopsis thaliana>gb:AC006053_153170007302 (13)
JMSF016P15Sequence446001513 (11)gb:CLU89494_16479111e-32Canavalia lineata aspartate aminotransferase 2 precursor (AAT2) mRNA, complete c758007302 (13)gb:AB126259_1528262e-102Nicotiana tabacum mRNA for aspartate aminotransferase, partial cds.
JMSF039K02Sequence526007302 (13)gb:AB126259_15282622e-38Nicotiana tabacum mRNA for aspartate aminotransferase, partial cds.483007302 (13)gb:AB126259_15282622e-38Nicotiana tabacum mRNA for aspartate aminotransferase, partial cds.
JMSF043P13Sequence783001513 (11)gb:CLJ001360_16478484e-78Canavalia lineata gene for aspartate aminotransferase 2.679007302 (13)gb:AB126259_15282621e-65Nicotiana tabacum mRNA for aspartate aminotransferase, partial cds.
JMSF044H08Sequence794001513 (11)gb:CLJ001360_16478481e-83Canavalia lineata gene for aspartate aminotransferase 2.786007302 (13)gb:AB126259_15282626e-98Nicotiana tabacum mRNA for aspartate aminotransferase, partial cds.
JMSF046M09Sequence805001513 (11)gb:S60967_17043377e-65Glycine max aspartate aminotransferase isozyme 5 mRNA, complete cds; chloroplast789007302 (13)gb:AB126259_15282622e-87Nicotiana tabacum mRNA for aspartate aminotransferase, partial cds.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF016P15+ CNAGAGAAGAACCACATTCCGTTTTTTGATGTTGCCTATCAGGGA-TTT
rJMSF046M09+ TTTTTTGATGTTGCCTATCAGGGATTTT
rJMFF031H09+ TTT
rJMSF044H08+ TTTTTTGATGTTGCCTATCAGGGA-TTT
                      ____________________________________________________________
consensus CNAGAGAAGAACCACATTCCGTTTTTTGATGTTGCCTATCAGGGA-TTT
 
. : . : . : . : . : . :
rJMSF016P15+ GCGAGTGGTAGCCTTGATGCAGATGCATCATCTGTGAGAATGTTTGCTTCACGTGGGTTG
rJMSF046M09+ GCGAGTGGTAGCCNTGATGCAGATGCATCATCTGTGAGAATGTTTGCTTCACGTGGGTNG
rJMFF031H09+ GCGAGTGGTAGCCTTGATGCAGATGCATCATCTGTGAGAATGTTTGCTTCACGTGGGTTG
rJMFF025A23+ GAGTGGTAGCNTTGATGCAGATGCATCATCTGTGAGAATGTTTGCTTCACGTGGGTTG
rJMSF044H08+ GCGAGTGGTAGCCTTGATGCAGATGCATCATCTGTGAGAATGTTTGCTTCACGTGGGTTG
                      ____________________________________________________________
consensus GCGAGTGGTAGCCTTGATGCAGATGCATCATCTGTGAGAATGTTTGCTTCACGTGGGTTG
 
. : . : . : . : . : . :
rJMSF016P15+ GAGCTGCTTGTTGCTCAGTCGTACAGTAAGAATCTGGGTCTTTATGCTGAAAGGATTGGA
rJMSF046M09+ GAGCTGCTTGTTGCTCAGTCGTACAGTAAGAATCTGGGTCTTTATGCTGAAAGGATTGGA
rJMFF031H09+ GAGCTGCTTGTTGCTCAGTCGTACAGTAAGAATCTGGGTCTTTATGCTGAAAGGATTGGA
rJMFF030O10+ GAGCTGCTTGTTGCTCAGTCGTACAGTAAGAATCTGGGTCTTTATGCTGAAAGGATTGGA
rJMFF025A23+ GAGCTGCTTGTTGCTCAGTCGTACAGTAAGAATCTGGGTCTTTATGCTGAAAGGATTGGA
rJMSF044H08+ GAGCTGCTTGTTGCTCAGTCGTACAGTAAGAATCTGGGTCTTTATGCTGAAAGGATTGGA
rJMSF043P13+ TGGA
                      ____________________________________________________________
consensus GAGCTGCTTGTTGCTCAGTCGTACAGTAAGAATCTGGGTCTTTATGCTGAAAGGATTGGA
 
. : . : . : . : . : . :
rJMSF016P15+ GCTATCAATGTTGTTTGCTCATCAGCGGATGCAGCAGCAAGGGTG-AAAAGCCAACTGAA
rJMSF046M09+ GCTATCAATGTTGTTTGCTCATCAGCGGATGCAGCAGCAAGGGTG-AAAAGCCAACTGAA
rJMFF031H09+ GCTATCAATGTTGTTTGCTCATCAGCGGATGCAGCAGCAAGGGTG-AAAAGCCAACTGAA
rJMFF030O10+ GCTATCAATGTTGTTTGCTCATCAGCGGATGCAGCAGCAAGGGTG-AAAAGCCAACTGAA
rJMFF025A23+ GCTATCAATGTTGTTTGCTCATCAGCGGATGCAGCAGCAAGGGTG-AAAAGCCAACTGAA
rJMSF044H08+ GCTATCAATGTTGTTTGCTCATCAGCGGATGCAGCAGCAAGGGTG-AAAAGCCAACTGAA
rJMFF043O07+ GAA
rJMSF043P13+ GCTATCAATGTTGTTTGCTCATCAGCGGATGCAGCAGCAAGGGTGAAAAAGCCAACTGAA
                      ____________________________________________________________
consensus GCTATCAATGTTGTTTGCTCATCAGCGGATGCAGCAGCAAGGGTG-AAAAGCCAACTGAA
 
. : . : . : . : . : . :
rJMSF016P15+ GA-GGCTGGCACGGCCAATGTACTCAAATCCTCCCATACATGGAGCTAGGATTGTTGCCA
rJMSF046M09+ GA-GGCTGGCACGGCCAATGTACTCAAATCCTCCCATACATGGAGCTAGGATTGTTGCCA
rJMFF031H09+ GA-GGCTGGCACGGCCAATGTACTCAAATCCTCCCATACATGGAGCTAGGATTGTTGCCA
rJMFF030O10+ GA-GGCTGGCACGGCCAATGTACTCAAATCCTCCCATACATGGAGCTAGGATTGTTGCCA
rJMFF025A23+ GA-GGCTGGCACGGCCAATGTACTCAAATCCTCCCATACATGGAGCTAGGATTGTTGCCA
rJMSF044H08+ GA-GGCTGGCACGGCCAATGTACTCAAATCCTCCCATACATGGAGCTAGGATTGTTGCCA
rJMFF043O07+ GA-GGCTGGCACGGCCAATGTACTCAAATCCTCCCATACATGGAGCTAGGATTGTTGCCA
rJMSF043P13+ GAGGGCTGGCACGGCCAATGTACTCAAATCCTCCCATACATGGAGCTAGGATTGTTGCCA
                      ____________________________________________________________
consensus GA-GGCTGGCACGGCCAATGTACTCAAATCCTCCCATACATGGAGCTAGGATTGTTGCCA
 
. : . : . : . : . : . :
rJMSF016P15+ ATGTCGTAGGAAACCCCGAGCTCTTCAATGAATGGAAACAAGAGATGGAAATGATGGCAG
rJMSF046M09+ ATGTCGTAGGAAACCCCGAGCTCTTCAATGAATGGAAACAAGAGATGGAAATGATGGCAG
rJMFF031H09+ ATGTCGTAGGAAACCCCGAGCTCTTCAATGAATGGAAACAAGAGATGGAAATGATGGCAG
rJMFF030O10+ ATGTCGTAGGAAACCCCGAGCTCTTCAATGAATGGAAACAAGAGATGGAAATGATGGCAG
rJMSF005C21+ CTTCAATGAATGGAAACAAGAGATGGAAATGATGGCAG
rJMFF025A23+ ATGTCGTAGGAAACCCCGAGCTCTTCAATGAATGGAAACAAGAGATGGAAATGATGGCAG
rJMSF044H08+ ATGTCGTAGGAAACCCCGAGCTCTTCAATGAATGGAAACAAGAGATGGAAATGATGGCAG
rJMFF043O07+ ATGTCGTAGGAAACCCCGAGCTCTTCAATGAATGGAAACAAGAGATGGAAATGATGGCAG
rJMSF043P13+ ATGTCGTAGGAAACCCCGAGCTCTTCAATGAATGGAAACAAGAGATGGAAATGATGGCAG
                      ____________________________________________________________
consensus ATGTCGTAGGAAACCCCGAGCTCTTCAATGAATGGAAACAAGAGATGGAAATGATGGCAG
 
. : . : . : . : . : . :
rJMSF016P15+ GGAGGATAAAGAGCGTGAGGCAAAAACTATATGACAGCCTGTCTTTGAAGGACAAGAGTG
rJMSF046M09+ GGAGGATAAAGAGCGTGAGGCAAAAACTATATGACAGCCTGTCTTTGAAGGACAAGAGTG
rJMFF031H09+ GGAGGATAAAGAGCGTGAGGCAAAAACTATATGACAGCCTGTCTTTGAAGGACAAGAGTG
rJMFF030O10+ GGAGGATAAAGAGCGTGAGGCAAAAACTATATGACAGCCTGTCTTTGAAGGACAAGAGTG
rJMSF005C21+ GGAGGGTAAAGAGCGTGAGGCAAAANCTATATGACAGCCTGTCTTTGAAGGACAAGAGTG
rJMFF025A23+ GGAGGATAAAGAGCGTGAGGCAAAAACTATATGACAGCCTGTCTTTGAAGGACAAGAGTG
rJMSF044H08+ GGAGGATAAAGAGCGTGAGGCAAAAACTATATGACAGCCTGTCTTTGAAGGACAAGAGTG
rJMFF043O07+ GGAGGATAAAGAGCGTGAGGCAAAAACTATATGACAGCCTGTCTTTGAAGGACAAGAGTG
rJMSF043P13+ GGAGGATAAAGAGCGTGAGGCAAAAACTATATGACAGCCTGTCTTTGAAGGACAAGAGTG
rJMSF039K02+ GTGAGGCAAAAACTATATGACAGCCTGTCTTTGAAGGACAAGAGTG
JMSF039K02- GTGAGGCAAAAACTATATGACAGCCTGTCTTTGAAGGACAAGAGTG
                      ____________________________________________________________
consensus GGAGGATAAAGAGCGTGAGGCAAAAACTATATGACAGCCTGTCTTTGAAGGACAAGAGTG
 
. : . : . : . : . : . :
rJMSF016P15+ GGAAGGACTGGACATTTATTCTGAAGCAGATTGGCATGTTTTCCTTTACCGGCCTGAATA
rJMSF046M09+ GGAAGGACTGGACATTTATTCTGAAGCAGATTGGCATGTTTTCCTTTACCGGCCTGAATA
rJMFF031H09+ GGAAGGACTGGACATTTATTCTGAAGCAGATTGGCATGTTTTCCTTTACCGGCCTGAATA
rJMFF030O10+ GGAAGGACTGGACATTTATTCTGAAGCAGATTGGCATGTTTTCCTTTACCGGCCTGAATA
rJMSF005C21+ GGAAGGACTGGACATTTATTCTGAAGCAGATTGGCATGTTTTCCTTTACCGGCCTGAATA
rJMFF025A23+ GGAAGGACTGGACATTTATTCTGAAGCAGATTGGCATGTTTTCCTTTACCGGCCTGAATA
rJMSF044H08+ GGAAGGACTGGACATTTATTCTGAAGCAGATTGGCATGTTTTCCTTTACCGGCCTGAATA
rJMFF043O07+ GGAAGGACTGGACATTTATTCTGAAGCAGATTGGCATGTTTTCCTTTACCGGCCTGAATA
rJMSF043P13+ GGAAGGACTGGACATTTATTCTGAAGCAGATTGGCATGTTTTCCTTTACCGGCCTGAATA
rJMSF039K02+ GGAAGGACTGGACATTTATTCTGAAGCAGATTGGCATGTTTTCCTTTACCGGCCTGAATA
rJMSF004N05+ CCTGAATA
JMSF039K02- GGAAGGACTGGACATTTATTCTGAAGCAGATTGGCATGTTTTCCTTTACCGGCCTGAATA
                      ____________________________________________________________
consensus GGAAGGACTGGACATTTATTCTGAAGCAGATTGGCATGTTTTCCTTTACCGGCCTGAATA
 
. : . : . : . : . : . :
rJMSF016P15+ AAGCTCAGAGCGAAAACATGTCGAATAAGTGGCATATATACATGACCAAAGATGGAAGAA
rJMSF046M09+ AAGCTCAGAGCGAAAACATGTCGAATAAGTGGCATATATACATGACCAAAGATGGAAGAA
rJMFF031H09+ AAGCTCAGAGCGAAAACATGTCGAATAAGTGGCATATATACATGACCAAAGATGGAAGAA
rJMFF030O10+ AAGCTCAGAGCGAAAACATGTCGAATAAGTGGCATATATACATGACCAAAGATGGAAGAA
rJMSF005C21+ AAGCTCAGAGCGAAAACATGTCGAATAAGTGGCATATATACATGACCAAAGATGGAAGAA
rJMFF025A23+ AAGCTCAGAGCGAAAACATGTCGAATAAGTGGCATATATACATGACCAAAGATGGAAGAA
rJMSF044H08+ AAGCTCAGAGCGAAAACATGTCGAATAAGTGGCATATATACATGACCAAAGATGGAAGAA
rJMFF043O07+ AAGCTCAGAGCGAAAACATGTCGAATAAGTGGCATATATACATGACCAAAGATGGAAGAA
rJMSF043P13+ AAGCTCAGAGCGAAAACATGTCGAATAAGTGGCATATATACATGACCAAAGATGGAAGAA
rJMSF039K02+ AAGCTCAGAGCGAAAACATGTCGAATAAGTGGCATATATACATGACCAAAGATGGAAGAA
rJMSF004N05+ AANCTCAGAGCGAAACCATGTCGAATAAGTGGCACATATACATGNCCAAAGATGGAAGAA
JMSF039K02- AAGCTCAGAGCGAAAACATGTCGAATAAGTGGCATATATACATGACCAAAGATGGAAGAA
                      ____________________________________________________________
consensus AAGCTCAGAGCGAAAACATGTCGAATAAGTGGCATATATACATGACCAAAGATGGAAGAA
 
. : . : . : . : . : . :
rJMSF016P15+ TATCCTTGGCTGGCTTATCTGCAGCGAAGTGCGAATATCTTGCAGATGCCATCATTGATT
rJMSF046M09+ TATCCTTGGCTGGCTTATCTGCAGCGAAGTGCGAATATCTTGCAGATGCCATCATTGATT
rJMFF031H09+ TATCCTTGGCTGGCTTATCTGCAGCGAAGTGCGAATATCTTGCAGATGCCATCATTGATT
rJMFF030O10+ TATCCTTGGCTGGCTTATCTGCAGCGAAGTGCGAATATCTTGCAGATGCCATCATTGATT
rJMSF005C21+ TATCCTTGGCTGGCTTATCTGCAGCGAAGTGCGAATATCTTGCAGATGCCATCATTGATT
rJMFF025A23+ TATCCTTGGCTGGCTTATCTGCAGCGAAGTGCGAATATCTTGCAGATGCCATCATTGATT
rJMSF044H08+ TATCCTTGGCTGGCTTATCTGCAGCGAAGTGCGAATATCTTGCAGATGCCATCATTGATT
rJMFF043O07+ TATCCTTGGCTGGCTTATCTGCAGCGAAGTGCGAATATCTTGCAGATGCCATCATTGATT
rJMSF043P13+ TATCCTTGGCTGGCTTATCTGCAGCGAAGTGCGAATATCTTGCAGATGCCATCATTGATT
rJMSF039K02+ TATCCTTGGCTGGCTTATCTGCAGCGAAGTGCGAATATCTTGCAGATGCCATCATTGATT
rJMSF004N05+ TNTCCTTGGCTGGCTTATNTGCAGCGANGTGCGAATATCNTGCAGATGCCATCATTGATT
JMSF039K02- TATCCTTGGCTGGCTTATCTGCAGCGAAGTGCGAATATCTTGCAGATGCCATCATTGATT
                      ____________________________________________________________
consensus TATCCTTGGCTGGCTTATCTGCAGCGAAGTGCGAATATCTTGCAGATGCCATCATTGATT
 
. : . : . : . : . : . :
rJMSF016P15+ CATATTACAATGTCAGCTAGATAAATAAGACTGGAAGTACATTTTCATAGCAATTTTGAT
rJMSF046M09+ CATATTACAATGTCAGCTAGATAAATAAGACTGGAAGTACATTTTCATAGCAATTTTGAT
rJMFF031H09+ CATATTACAATGTCAGCTAGATAAATAAGACTGGAAGTACATTTTCATAGCAATTTTGAT
rJMFF030O10+ CATATTACAATGTCAGCTAGATAAATAAGACTGGAAGTACATTTTCATAGCAATTTTGAT
rJMSF005C21+ CATATTACAATGTCAGCTAGATAAATAAGACTGGAAGTACATTTTCATAGCAATTTTGAT
rJMFF025A23+ CATATTACAATGTCAGCTAGATAAATAAGACTGGAAGTACATTTTCATAGCAATTTTGAT
rJMSF044H08+ CATATTACAATGTCAGCTAGATAAATAAGACTGGAAGTACATTTTCATAGCAATTTTGAT
rJMFF043O07+ CATATTACAATGTCAGCTAGATAAATAAGACTGGAAGTACATTTTCATAGCAATTTTGAT
rJMSF043P13+ CATATTACAATGTCAGCTAGATAAATAAGACTGGAAGTACATTTTCATAGCAATTTTGAT
rJMSF039K02+ CATATTACAATGTCAGCTAGATAAATAAGACTGGAAGTACATTTTCATAGCAATTTTGAT
rJMSF004N05+ CANATCACAATGTCAGCTNGATAAATAAGACTGGAAGTACATTNTCATAGCAATTTTGAT
JMSF039K02- CATATTACAATGTCAGCTAGATAAATAAGACTGGAAGTACATTTTCATAGCAATTTTGAT
                      ____________________________________________________________
consensus CATATTACAATGTCAGCTAGATAAATAAGACTGGAAGTACATTTTCATAGCAATTTTGAT
 
. : . : . : . : . : . :
rJMSF016P15+ GAGTTACTTTGTTTCACTCTTTGATCCAATGACTTTTAACAAATCTTATAATAATAGTTG
rJMSF046M09+ GAGTTACTTTGTTTCACTCTTTGATCCAATGACTTTTAACAAATCTTATAATAATAGTTG
rJMFF031H09+ GAGTTACTTTGTTTCACTCTTTGATCCAATGACTTTTAACAAATCTTATAATAATAGTTG
rJMFF030O10+ GAGTTACTTTGTTTCACTCTTTGATCCAATGACTTTTAACAAATCTTATAATAATAGTTG
rJMSF005C21+ GAGTTACTTTGTNTCACTCTTTGATCCAATGACTTTTAACAAATCTTATAATAATAGTTG
rJMFF025A23+ GAGTTACTTTGTTTCACTCTTTGATCCAATGACTTTTAACAAATCTTATAATAATAGTTG
rJMSF044H08+ GAGTTACTTTGTTTCACTCTTTGATCCAATGACTTTTAACAAATCTTATAATAATAGTTG
rJMFF043O07+ GAGTTACTTTGTTTCACTCTTTGATCCAATGACTTTTAACAAATCTTATAATAATAGTTG
rJMSF043P13+ GAGTTACTTTGTTTCACTCTTTGATCCAATGACTTTTAACAAATCTTATAATAATAGTTG
rJMSF039K02+ GAGTTACTTTGTTTCACTCTTTGATCCAATGACTTTTAACAAATCTTATAATAATAGTTG
rJMSF004N05+ GAGTTACTTTGTTTCACTCTTTGATCCAATGACTTTTAACAAATCTTATAATAATAGTNG
rJMSF006H18+ TGACTCTTAACAANTCTNATAATAATCGTTG
JMSF039K02- GAGTTACTTTGTTTCACTCTTTGATCCAATGACTTTTAACAAATCTTATAATAATAGTTG
                      ____________________________________________________________
consensus GAGTTACTTTGTTTCACTCTTTGATCCAATGACTTTTAACAAATCTTATAATAATAGTTG
 
. : . : . : . : . : . :
rJMSF016P15+ TCCAGCATGATGATTTACCCATCAATTAGAAGAGCCATTGGATTCAGAATAT
rJMSF046M09+ TCCAGCATGATGATTTACCCATCAATTAGAAGAGCCATTGGATTCAGAAAATATTGTAAT
rJMFF031H09+ TCCAGCATGATGATTTACCCATCAATTAGAAGAGCCATTGGATTCAGAATATATTGTAAT
rJMFF030O10+ TCCAGCATGATGATTTACCCATCAATTAGAAGAGCCATTGGATTCAGAATATATTGTAAT
rJMSF005C21+ TCCAGCATGATGATTTACCCATCAATTAGAAGAGCCATTGGATTCAGAATATATTGTAAT
rJMFF025A23+ TCCAGCATGATGATTTACCCATCAATTAGAAGAGCCATTGGATTCAGAATATATTGTAAT
rJMSF044H08+ TCCAGCATGATGATTTACCCATCAATTAGAAGAGCCATCGGATTCAGAATATATTGTAAT
rJMFF043O07+ TCCAGCATGATGATTTACCCATCAATTAGAAGAGCCATTGGATTCAGAATATATTGTAAT
rJMSF043P13+ TCCAGCATGATGATTTACCCATCAATTAGAAGAGCCATTGGATTCAGAATATATTGTAAT
rJMSF039K02+ TCCAGCATGATGATTTACCCATCAATTAGAAGAGCCATTGGATTCAGAATATATTGTAAT
rJMSF004N05+ TCCAGCATGATGATTTACCCATCAATTAGAAGAGCC
rJMSF006H18+ TCCNGCACNANGATTTACCCATCAATTNGAAGAGCCATTGGATTCAGAATATATNGTAAT
JMSF039K02- TCCAGCATGATGATTTACCCATCAATTAGAAGAGCCATTGGATTCAGAATATATTGTAAT
                      ____________________________________________________________
consensus TCCAGCATGATGATTTACCCATCAATTAGAAGAGCCATTGGATTCAGAATATATTGTAAT
 
. : . : . : . : . : . :
rJMSF046M09+ -AATGGTTTTTCAATGTTA-GGTTGTGCCAAGAAATTT
rJMFF031H09+ -AATGGTTTTTCAATGTTA-GGTTGTGCCAAGAAATTT
rJMFF030O10+ -AATGGTTTTTCAATGTTA-GGTTGTGCCAAGAAATT
rJMSF005C21+ -AATGG
rJMFF025A23+ -AATGGTTTTTCAATGTTA-GGTTGTGCCAAGAAATTT
rJMSF044H08+ -AATGGTTTTTCAATGTTA-GGTTGTGCCAAGAAATTT
rJMFF043O07+ -AATGGTTTTTCAATGTTA-GGTTGTGCCAAGAAATTTTGGAACTTTTTGAATGTAAGGT
rJMSF043P13+ -AATGGTTTTTCAATGTTA-GGTTGTGCCAAGAAATTTTGGAACTTTTTGAATGTAAGGT
rJMSF039K02+ -AATGGTTTTTCAATGTTA-GGTTGTGCCAAGAAATTTTGGAACTTTTTGAATGTAAGGT
rJMSF006H18+ CAATGGTTTCTCAATGTTAGGGTTGTGCCCAGCAATTTTGGAACTTTTCGAATGTAAGCT
JMSF039K02- -AATGGTTTTTCAATGTTA-GGTTGTGCCAAGAAATTTTGGAACTTTTTGAATGTAAGGT
                      ____________________________________________________________
consensus -AATGGTTTTTCAATGTTA-GGTTGTGCCAAGAAATTTTGGAACTTTTTGAATGTAAGGT
 
. : . : . : . : . : . :
rJMFF043O07+ TTTGC
rJMSF043P13+ TTTGCGTAAGAGATC
rJMSF039K02+ TTTGCGTAAGAGATC
rJMSF006H18+ TTTGCGTAAGAGATC
JMSF039K02- TTTGCGTAAGAGATCTTTGTGTGATATGTCAATCCCATTAAATTTACTTGGTAANANANA
                      ____________________________________________________________
consensus TTTGCGTAAGAGATCTTTGTGTGATATGTCAATCCCATTAAATTTACTTGGTAANANANA