Previous Contig 007298:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF031N10Sequence210007298 (2)721013233 (2)pir|E84799|E847994e-19similar to axi 1 protein from Nicotiana tabacum [imported] - Arabidopsis thalian
JMSF039J10Sequence329007298 (2)875013233 (2)pir|E84799|E847991e-44similar to axi 1 protein from Nicotiana tabacum [imported] - Arabidopsis thalian

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF039J10+ TCTGAAAGTTTCTCNCCGGCGTTCGGGGC
                      ____________________________________________________________
consensus TCTGAAAGTTTCTCNCCGGCGTTCGGGGC
 
. : . : . : . : . : . :
JMSF039J10+ CTCTGTAAAANGACGACGGTGGTGCGTATGGGGGCTTCCGCCGGCGGAGCCGGCAATGGT
                      ____________________________________________________________
consensus CTCTGTAAAANGACGACGGTGGTGCGTATGGGGGCTTCCGCCGGCGGAGCCGGCAATGGT
 
. : . : . : . : . : . :
JMFF031N10+ AATAGTGCGTTATACGAGGA
JMSF039J10+ CGGCATTCTCCCGGAGAGANCAACGCAAACAAAACANCAAAATANTGCGTTATACGAGGA
                      ____________________________________________________________
consensus CGGCATTCTCCCGGAGAGANCAACGCAAACAAAACANCAAAATAGTGCGTTATACGAGGA
 
. : . : . : . : . : . :
JMFF031N10+ AACCGATCGCGCTACAAGGCAGAGATCTTTCTAATTTCCTATNGTGTGCCGTTGCTTTGT
JMSF039J10+ AACCGATCGCGCTACAAGGCAGAGATCTTTCTAATTTCNTATTGTGTGCCGTTGCTTTGT
                      ____________________________________________________________
consensus AACCGATCGCGCTACAAGGCAGAGATCTTTCTAATTTCCTATTGTGTGCCGTTGCTTTGT
 
. : . : . : . : . : . :
JMFF031N10+ TTGTGTATAGAGATAGAGATAGAAAGAGAGAGATAGAGAGAGAGAGAGAGAGAGGGAGAG
JMSF039J10+ TTGTGTATAGAGATAGAGATAGAAAGAGAGAGATAGAGAGAGAGAGAGAGAGAGGGAGAG
                      ____________________________________________________________
consensus TTGTGTATAGAGATAGAGATAGAAAGAGAGAGATAGAGAGAGAGAGAGAGAGAGGGAGAG
 
. : . : . : . : . : . :
JMFF031N10+ AGAGAGAGAGGGGTGTACGACAATTCTCTCTCTCTAAAAAAAGGTTGTTCTTTAAG
JMSF039J10+ AGAGAGAGAGGGGTGTACGACAATTCTCTCTCTCTAAAAAAAGGTTGTTCTTTAAGCGTC
                      ____________________________________________________________
consensus AGAGAGAGAGGGGTGTACGACAATTCTCTCTCTCTAAAAAAAGGTTGTTCTTTAAGCGTC