Previous Contig 007292:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF040B11Sequence496007292 (3)gb:AC005724_15329532e-52Arabidopsis thaliana chromosome 2 clone MSF3 map CIC06E08, complete sequence.706010062 (3)gb:CAR271658_16451793e-31Cicer arietinum partial mRNA for calmodulin-binding protein.
JMFS132F04Sequence477007292 (3)gb:AC005724_15329539e-25Arabidopsis thaliana chromosome 2 clone MSF3 map CIC06E08, complete sequence.
JMSF039I23Sequence692007292 (3)gb:AC005724_15329537e-84Arabidopsis thaliana chromosome 2 clone MSF3 map CIC06E08, complete sequence.758010062 (3)gb:CAR271658_16451795e-35Cicer arietinum partial mRNA for calmodulin-binding protein.

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF039I23+ TGATCCAGCTAGAGTTGTCGGTAAATGTCAAC
                      ____________________________________________________________
consensus TGATCCAGCTAGAGTTGTCGGTAAATGTCAAC
 
. : . : . : . : . : . :
JMSF039I23+ TCACCAAGGGTGCCTACACCATCCTTTAATATCACTTGCGATTCCCCAGCTAGAAGTGGC
                      ____________________________________________________________
consensus TCACCAAGGGTGCCTACACCATCCTTTAATATCACTTGCGATTCCCCAGCTAGAAGTGGC
 
. : . : . : . : . : . :
JMSF039I23+ CTCTTTCCTTCCCGCTCTTTCACTATATGAGACTCGAATTCTTCATGAGTCCAACCATTC
                      ____________________________________________________________
consensus CTCTTTCCTTCCCGCTCTTTCACTATATGAGACTCGAATTCTTCATGAGTCCAACCATTC
 
. : . : . : . : . : . :
JMSF039I23+ TCGTCCTCATTGTTGAAGTCTCCTTCAAGTACAACAACATCTAATTTGACCGACGATTCC
                      ____________________________________________________________
consensus TCGTCCTCATTGTTGAAGTCTCCTTCAAGTACAACAACATCTAATTTGACCGACGATTCC
 
. : . : . : . : . : . :
JMSF039I23+ GGACCTGATGTTACAACATGGCCTGTATTTCCATCAATCAAGACAATATGGACCGCAGAA
                      ____________________________________________________________
consensus GGACCTGATGTTACAACATGGCCTGTATTTCCATCAATCAAGACAATATGGACCGCAGAA
 
. : . : . : . : . : . :
JMSF039I23+ CCTTGTTCTCCTTCAACCTTCCCTCCTGTAAAGAGAGGCAGCGACAATTTGGACCTGAAA
                      ____________________________________________________________
consensus CCTTGTTCTCCTTCAACCTTCCCTCCTGTAAAGAGAGGCAGCGACAATTTGGACCTGAAA
 
. : . : . : . : . : . :
JMFF040B11+ CCTTGCATTA
JMSF039I23+ TGGAGCTGTAAACTTCTTCCATCTGGCCCTTCCAGTCTTTTTGGAGAAGCCCTTGCATTA
                      ____________________________________________________________
consensus TGGAGCTGTAAACTTCTTCCATCTGGCCCTTCCAGTCTTTTTGGAGAAGCCCTTGCATTA
 
. : . : . : . : . : . :
JMFS132F04+ CTTTGCCAATGCACGTTCCACTTCTTCACTAACAACTCTCCGA
JMFF040B11+ ATTTGGGAAGGGCCCAGCTTTGCCAATGCACGTTCCACTTCTTCACTAACAACTCTCCGA
JMSF039I23+ ATTTGGGAAGGGCCCAGCTTTGCCAATGCACGTTCCACTTCTTCACTAACAACTCTCCGA
                      ____________________________________________________________
consensus ATTTGGGAAGGGCCCAGCTTTGCCAATGCACGTTCCACTTCTTCACTAACAACTCTCCGA
 
. : . : . : . : . : . :
JMFS132F04+ AGAATTGGCTCCAGGGATGAACAAAGTTTCTGCAGACTGTCCACCTTAAGTGCCTCAATA
JMFF040B11+ AGAATTGGCTCCAGGGATGAACAAAGTTTCTGCAGACTGTCCACCTTAAGTGCCTCAATA
JMSF039I23+ AGAATTGGCTCCAGGGATGAACAAAGTTTCTGCAGACTGTCCACCTTAAGTGCCTCAATA
                      ____________________________________________________________
consensus AGAATTGGCTCCAGGGATGAACAAAGTTTCTGCAGACTGTCCACCTTAAGTGCCTCAATA
 
. : . : . : . : . : . :
JMFS132F04+ ATAACACTGGCAAGAGCAGGACGTTTCCTATCGGGTTGACCCTCTTCACTCCCACTACCC
JMFF040B11+ ATAACACTGGCAAGAGCAGGACGTTTCCTATCGGGTTGACCCTCTTCACTCCCACTACCC
JMSF039I23+ ATAACACTGGCAAGAGCAGGACGTTTCCTATCGGGTTGACCCTCTTCACTCCCACTACCC
                      ____________________________________________________________
consensus ATAACACTGGCAAGAGCAGGACGTTTCCTATCGGGTTGACCCTCTTCACTCCCACTACCC
 
. : . : . : . : . : . :
JMFS132F04+ GGAT
JMFF040B11+ GGATCCAGAGCCCGTTTCTCCCGGGCCACAGTCGAAGATCTTTCCATATACCTAGTCTGC
JMSF039I23+ GGATCCAGAGCCCGTTTCTCCCGGGCCACAGTCGAAGATCTTTCCATATACCTAGTCTGC
                      ____________________________________________________________
consensus GGATCCAGAGCCCGTTTCTCCCGGGCCACAGTCGAAGATCTTTCCATATACCTAGTCTGC
 
. : . : . : . : . : . :
JMFF040B11+ ATTTTCCAGGAAACACAACAGTGCCTCAGACCACTTCTCCACACACTCTCTCCAGATC
JMSF039I23+ ATTTTCCAGGAAACACAACAGTGCCTCAGACCACTTCTCCACACACTCTCTCCAGATCCC
                      ____________________________________________________________
consensus ATTTTCCAGGAAACACAACAGTGCCTCAGACCACTTCTCCACACACTCTCTCCAGATCCC