Previous Contig 007289:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF023J06Sequence636007289 (3)197013724 (3)
JMSF039I06Sequence636007289 (3)583013724 (3)
JMSF047J11Sequence663007289 (3)198013724 (3)

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF047J11+ CT
                      ____________________________________________________________
consensus CT
 
. : . : . : . : . : . :
JMSF047J11+ GACTTGCTGCTTGGCACACCATAACTCCTTTCAATCCTGGACTGAACTTCAAAATCTATG
JMSF023J06+ CTGGACTGAACTTCAAAATCTATG
                      ____________________________________________________________
consensus GACTTGCTGCTTGGCACACCATAACTCCTTTCAATCCTGGACTGAACTTCAAAATCTATG
 
. : . : . : . : . : . :
JMSF047J11+ CAAAAGACTAGTCTGGAGCACAAGACAATTAGACACACAAAACGGAAGGTCAAACTAAAG
JMSF023J06+ CAAAAGACTAGTCTGGAGCACAAGACAATTAGACACACAAAACGGAAGGTCAAACTAAAG
                      ____________________________________________________________
consensus CAAAAGACTAGTCTGGAGCACAAGACAATTAGACACACAAAACGGAAGGTCAAACTAAAG
 
. : . : . : . : . : . :
JMSF047J11+ CAAGGATCGATGAATTTGGGCTAACTTGAGGCAGACTTTAGAGGTGATGGAATTGGAAAT
JMSF023J06+ CAAGGATCGATGAATTTGGGCTAACTTGAGGCAGACTTTAGAGGTGATGGAATTGGAAAT
                      ____________________________________________________________
consensus CAAGGATCGATGAATTTGGGCTAACTTGAGGCAGACTTTAGAGGTGATGGAATTGGAAAT
 
. : . : . : . : . : . :
JMSF047J11+ TTCAACAAGAAACAAAGCTGGGCATAACAAGAAGAAGAAGAAGAAGAAGAAGAAGACCAA
JMSF023J06+ TTCAACAAGAAACAAAGCTGGGCATAACAAGAAGAAGAAGAAGAAGAAGAAGAAGACCAA
                      ____________________________________________________________
consensus TTCAACAAGAAACAAAGCTGGGCATAACAAGAAGAAGAAGAAGAAGAAGAAGAAGACCAA
 
. : . : . : . : . : . :
JMSF047J11+ ATTTAGTTTCTAAAACTCGGTTATTTAGCTAATCCTATGGATAAAACAAGCAAAGAAAAA
JMSF023J06+ ATTTAGTTTCTAAAACTCGGTTATTTAGCTAATCCTATGGATAAAACAAGCAAAGAAAAA
                      ____________________________________________________________
consensus ATTTAGTTTCTAAAACTCGGTTATTTAGCTAATCCTATGGATAAAACAAGCAAAGAAAAA
 
. : . : . : . : . : . :
JMSF047J11+ AAGATGATTGGCACCCATGGGTAGCTAGTAAAAGAGGATAGTGAGAGGGCTGAATAGGTT
JMSF023J06+ AAGATGATTGGCACCCATGGGTAGCTAGTAAAAGAGGATAGTGAGAGGGCTGAATAGGTT
                      ____________________________________________________________
consensus AAGATGATTGGCACCCATGGGTAGCTAGTAAAAGAGGATAGTGAGAGGGCTGAATAGGTT
 
. : . : . : . : . : . :
JMSF047J11+ CACAGAAGAAACATGTTTACAGAATCACCCTGCAATATAAGTTCAAGGAGATAACATAAC
JMSF023J06+ CACAGAAGAAACATGTTTACAGAATCACCCTGCAATATAAGTTCAAGGAGATAACATAAC
JMSF039I06+ TCACCCTGCAATATAAGTTCAAGGAGATAACATAAC
                      ____________________________________________________________
consensus CACAGAAGAAACATGTTTACAGAATCACCCTGCAATATAAGTTCAAGGAGATAACATAAC
 
. : . : . : . : . : . :
JMSF047J11+ GAAACACATCAATCGATAGGCCCAGCCACCGCATACTATTCGCTTATATACTCAACCACA
JMSF023J06+ GAAACACATCAATCGATAGGCCCAGCCACCGCATACTATTCGCTTATATACACAACCACA
JMSF039I06+ GAAACACATCAATCGATAGGCCCAGCCACCGCATACTATTCGCTTATATACACAACCACA
                      ____________________________________________________________
consensus GAAACACATCAATCGATAGGCCCAGCCACCGCATACTATTCGCTTATATACACAACCACA
 
. : . : . : . : . : . :
JMSF047J11+ ACAGCATACACCAGAGAGATCAATTTTTGTTCACAGGAAAAATATCTGCAGGGAAGATCG
JMSF023J06+ ACAGCATACACCAGAGAGATCAATTTTTGTTCACAGGAAAAATATCTGCAGGGAAGATCG
JMSF039I06+ ACAGCATACACCAGAGAGATCAATTTTTGTTCACAGGAAAAATATCTGCAGGGAAGATCG
                      ____________________________________________________________
consensus ACAGCATACACCAGAGAGATCAATTTTTGTTCACAGGAAAAATATCTGCAGGGAAGATCG
 
. : . : . : . : . : . :
JMSF047J11+ TTTGCCCAGTGCTCAGAAGGCCCAAACTTAAACAAATTTGTTAGTGTGAGGTAGATGGGG
JMSF023J06+ TTTGCCCAGTGCTCAGAAGGCCCAAACTTAAACAAATTTGTTAGTGTGAGGTAGATGGGG
JMSF039I06+ TTTGCCCAGTGCTCAGAAGGCCCAAACTTAAACAAATTTGTTAGTGTGAGGTAGATGGGG
                      ____________________________________________________________
consensus TTTGCCCAGTGCTCAGAAGGCCCAAACTTAAACAAATTTGTTAGTGTGAGGTAGATGGGG
 
. : . : . : . : . : . :
JMSF047J11+ AAGAAGGACAGGAGAGAAGTGAAGTGAACAGTGAAGCAGAGAAGCAGAGAGTTGCTGAAT
JMSF023J06+ AAGAAGGACAGGAGAGAAGTGAAGTGAACAGTGAAGCAGAGAAGCAGAGAGTTGCTGAAT
JMSF039I06+ AAGAAGGACAGGAGAGAAGTGAAGTGAACAGTGAAGCAGAGAAGCAGAGAGTTGCTGAAT
                      ____________________________________________________________
consensus AAGAAGGACAGGAGAGAAGTGAAGTGAACAGTGAAGCAGAGAAGCAGAGAGTTGCTGAAT
 
. : . : . : . : . : . :
JMSF023J06+ GAGGAAA
JMSF039I06+ GAGGAAAGAAGTAAGGAAACAAAGAGATGGTATGACTATATAAAAAATTTCTAGTTCAAG
                      ____________________________________________________________
consensus GAGGAAAGAAGTAAGGAAACAAAGAGATGGTATGACTATATAAAAAATTTCTAGTTCAAG
 
. : . : . : . : . : . :
JMSF039I06+ AAATTTTTTTAGGCTTTAAGCCAATGAGGCTTCCATTCTTTTTTACAAATCTTATGCTTA
                      ____________________________________________________________
consensus AAATTTTTTTAGGCTTTAAGCCAATGAGGCTTCCATTCTTTTTTACAAATCTTATGCTTA
 
. : . : . : . : . : . :
JMSF039I06+ TATCATACATACATACATACAGTAATTAATTACAGCAAATTGTATCCCATACTGACTCAA
                      ____________________________________________________________
consensus TATCATACATACATACATACAGTAATTAATTACAGCAAATTGTATCCCATACTGACTCAA
 
. : . : . : . : . : . :
JMSF039I06+ AAATAATTGAATACAATATTTTAATGTCAAATGTCGATACACAAGAAATCTGCCTATTTT
                      ____________________________________________________________
consensus AAATAATTGAATACAATATTTTAATGTCAAATGTCGATACACAAGAAATCTGCCTATTTT
 
. : . : . : . : . : . :
JMSF039I06+ GGACATAACCATCATTGTCGCTGTCTACTGAACCAATGAGCTAAATCTGTGCGAATAATT
                      ____________________________________________________________
consensus GGACATAACCATCATTGTCGCTGTCTACTGAACCAATGAGCTAAATCTGTGCGAATAATT
 
. : . : . : . : . : . :
JMSF039I06+ ACACGAATATATACTTGACTAGACAAATCACTTCTACCCTTCAATCCTTAATAACAGGCC
                      ____________________________________________________________
consensus ACACGAATATATACTTGACTAGACAAATCACTTCTACCCTTCAATCCTTAATAACAGGCC