Previous Contig 007285:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF009D17Sequence557007285 (14)gb:AY136445_15819451e-50Arabidopsis thaliana unknown protein (At1g78150) mRNA, complete cds.>gb:BT000233726007285 (14)gb:AY063865_15658137e-45Arabidopsis thaliana unknown protein (At4g39860) mRNA, complete cds.>gb:AY117286
JMFF025J15Sequence791007285 (14)pir|T06092|T060922e-73hypothetical protein T5J17.30 - Arabidopsis thaliana>gb:ATCHRIV92_1547970 Arabid
JMFF037L18Sequence595007285 (14)gb:AY136445_15819451e-58Arabidopsis thaliana unknown protein (At1g78150) mRNA, complete cds.>gb:BT000233631007285 (14)gb:AY063865_15658132e-43Arabidopsis thaliana unknown protein (At4g39860) mRNA, complete cds.>gb:AY117286
JMFF050P24Sequence638007285 (14)gb:AY136445_15819451e-51Arabidopsis thaliana unknown protein (At1g78150) mRNA, complete cds.>gb:BT000233547010329 (18)gb:AF156372_17730283e-69Nicotiana tabacum clone PR60 60S ribosomal protein L2 mRNA, partial cds.
JMFN002D03Sequence584007285 (14)gb:AY136445_15819452e-57Arabidopsis thaliana unknown protein (At1g78150) mRNA, complete cds.>gb:BT000233
JMFN003A10Sequence622007285 (14)gb:AY063865_15658134e-57Arabidopsis thaliana unknown protein (At4g39860) mRNA, complete cds.>gb:AY117286
JMFN040L15Sequence555007285 (14)gb:AP005116_18481507e-56Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC clone:P070
JMFS043H12Sequence614007285 (14)gb:AY136445_15819451e-58Arabidopsis thaliana unknown protein (At1g78150) mRNA, complete cds.>gb:BT000233
JMSF024B16Sequence678007285 (14)gb:AY085560_15706293e-62Arabidopsis thaliana clone 15747 mRNA, complete sequence.786007285 (14)pir|T06092|T060926e-74hypothetical protein T5J17.30 - Arabidopsis thaliana>gb:ATCHRIV92_1547970 Arabid
JMSF039H11Sequence655007285 (14)gb:AY136445_15819452e-49Arabidopsis thaliana unknown protein (At1g78150) mRNA, complete cds.>gb:BT000233891007285 (14)pir|T06092|T060923e-81hypothetical protein T5J17.30 - Arabidopsis thaliana>gb:ATCHRIV92_1547970 Arabid

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF009D17- TTCTGCTTAATTAACAGGAATCTTTAGTAGTAATCCAGGTAGTATTA
                      ____________________________________________________________
consensus TTCTGCTTAATTAACAGGAATCTTTAGTAGTAATCCAGGTAGTATTA
 
. : . : . : . : . : . :
rJMFF037L18- GGGAAACATAAAATGTCAGTGATAAGC
rJMFF009D17- GCAATAGTGCATGGGATGTAACAAAATCAGAAAGGGAAACATAAAATGTCAGTGATAAGC
                      ____________________________________________________________
consensus GCAATAGTGCATGGGATGTAACAAAATCAGAAAGGGAAACATAAAATGTCAGTGATAAGC
 
. : . : . : . : . : . :
rJMFF037L18- TACTAGGTACTAGCAATGGCCAATGGGAACTAAATTAGCACTAATTCATACATTACCAAG
rJMFF009D17- TACTAGGTACTAGCAATGGCCAATGGGAACTAAATTAGCACTAATTCATACATTACCAAG
                      ____________________________________________________________
consensus TACTAGGTACTAGCAATGGCCAATGGGAACTAAATTAGCACTAATTCATACATTACCAAG
 
. : . : . : . : . : . :
rJMFF037L18- AAATATTCAAGTCTTTAGAATTGTTCTTACACCATGGCTCATGCATCTCGAATCTACCAG
rJMFF009D17- AAATATTCAAGTCTTTAGAATTGTTCTTACACCATGGCTCATGCATCTCGAATCTACCAG
JMFN003A10+ CATGCATCTCGAATCTACCAG
rJMSF024B16- AGTCTTTAGAATTGTTCTTACACCATGGCTCATGCATCTCGAATCTACCAG
rJMFF025J15- AGTCTTTAGAATTGTTCTTACACCATGGCTCATGCATCTCGAATCTACCAG
rJMSF039H11- GTCTTTAGAATTGTTCTTACACCATGGCTCATGCATCTCGAATCTACCAG
                      ____________________________________________________________
consensus AAATATTCAAGTCTTTAGAATTGTTCTTACACCATGGCTCATGCATCTCGAATCTACCAG
 
. : . : . : . : . : . :
rJMFF037L18- CCTCACTTGTCATTCTCATGAACCGTTAAGTGTACTTCATTAGTTAAAACCAGCAGCCTT
rJMFF009D17- CCTCACTTGTCATTCTCATGAACCGTTAAGTGTACTTCATTAGTTAAAACCAGCAGCCTT
JMFN003A10+ CCTCACTTGTCATTCTCATGAACCGTTAAGTGTACTTCATTAGTTAAAACCAGCAGCCTT
rJMSF024B16- CCTCACTTGTCATTCTCATGAACCGTTAAGTGTACTTCATTAGTTAAAACCAGCAGCCTT
rJMFF025J15- CCTCACTTGTCATTCTCATGAACCGTTAAGTGTACTTCATTAGTTAAAACCAGCAGCCTT
rJMSF039H11- CCTCACTTGTCATTCTCATGAACCGTTAAGTGTACTTCATTAGTTAAAACCAGCAGCCTT
                      ____________________________________________________________
consensus CCTCACTTGTCATTCTCATGAACCGTTAAGTGTACTTCATTAGTTAAAACCAGCAGCCTT
 
. : . : . : . : . : . :
rJMFF037L18- AGAAGGATCATAATTTACTATAAAACTTAAAACCAGTTTGATGAGAGTTAAAAGTTAAAC
rJMFF009D17- AGAAGGATCATAATTTACTATAAAACTTAAAACCAGTTTGATGAGAGTTAAAAGTTAAAC
JMFN003A10+ AGAAGGATCATAATTTACTATAAAACTTAAAACCAGTTTGATGAGAGTTAAAAGTTAAAC
rJMSF024B16- AGAAGGATCATAATTTACTATAAAACTTAAAACCAGTTTGATGAGAGTTAAAAGTTAAAC
rJMFF025J15- AGAAGGATCATAATTTACTATAAAACTTAAAACCAGTTTGATGAGAGTT-AAAGTTAAAC
rJMSF039H11- AGAAGGATCATAATTTACTATAAAACTTAAAACCAGTTTGATGAGAGTTAAAAGTTAAAC
                      ____________________________________________________________
consensus AGAAGGATCATAATTTACTATAAAACTTAAAACCAGTTTGATGAGAGTTAAAAGTTAAAC
 
. : . : . : . : . : . :
rJMFF037L18- AAGTGAAATGCTGCTCTCACCACCTGGTGGTTTGCGGACACCACCAAAGTAATCCCTGGA
rJMFF009D17- AAGTGAAATGCTGCTCTCACCACCTGGTGGTTTGCGGACACCACCAAAGTAATCCCTGGA
JMFN003A10+ AAGTGAAATGCTGCTCTCACCACCTGGTGGTTTGCGGACACCACCAAAGTAATCCCTGGA
rJMSF024B16- AAGTGAAATGCTGCTCTCACCACCTGGTGGTTTGCGGACACCACCAAAGTAATCCCTGGA
rJMFF025J15- AAGTGAAATGCTGCTCTCACCACCTGGTGGTTTGCGGACACCACCAAAGTAATCCCTGGA
rJMSF039H11- AAGTGAAATGCTGCTCTCACCACCTGGTGGTTTGCGGACACCACCAAAGTAATCCCTGGA
                      ____________________________________________________________
consensus AAGTGAAATGCTGCTCTCACCACCTGGTGGTTTGCGGACACCACCAAAGTAATCCCTGGA
 
. : . : . : . : . : . :
rJMFF037L18- TTGAACTTTTCCGTCAGCAAATATGTCATTGCCACTCATTTCTTTCAGCTTTGCCCTGCT
rJMFF009D17- TTGAACTTTTCCGTCAGCAAATATGTCATTGCCACTCATTTCTTTCAGCTTTGCCCTGCT
JMFN003A10+ TTGAACTTTTCCGTCAGCAAATATGTCATTGCCACTCATTTCTTTCAGCTTTGCCCTGCT
rJMSF024B16- TTGAACTTTTCCGTCAGCAAATATGTCATTGCCACTCATTTCTTTCAGCTTTGCCCTGCT
rJMFF025J15- TTGAACTTTTCCGTCAGCAAATATGTCATTGCCACTCATTTCTTTCAGCTTTGCCCTGCT
rJMSF039H11- TTGAACTTTTCCGTCAGCAAATATGTCATTGCCACTCATTTCTTTCAGCTTTGCCCTGCT
                      ____________________________________________________________
consensus TTGAACTTTTCCGTCAGCAAATATGTCATTGCCACTCATTTCTTTCAGCTTTGCCCTGCT
 
. : . : . : . : . : . :
rJMFF037L18- AAGATGCTTCTCAGCAGACCCTGGGACATCTCCCTTGAAAATGTCGTTGCCAGTCAACTC
rJMFF009D17- AAGATGCTTCTCAGCAGACCCTGGGACATCTCCCTTGAAAATGTCGTTGCCAGTCAACTC
JMFN003A10+ AAGATGCTTCTCAGCAGACCCTGGGACATCTCCCTTGAAAATGTCGTTGCCAGTCAAATC
rJMSF024B16- AAGATGCTTCTCAGCAGACCCTGGGACATCTCCCTTGAAAATGTCGTTGCCAGTCAACTC
rJMFF025J15- AAGATGCTTCTCAGCAGACCCTGGGACATCTCCCTTGAAAATGTCGTTGCCAGTCAACTC
JMFN040L15+ TTGCCAGTCAACTC
rJMSF039H11- AAGATGCTTCTCAGCAGACCCTGGGACATCTCCCTTGAAAATGTCGTTGCCAGTCAACTC
                      ____________________________________________________________
consensus AAGATGCTTCTCAGCAGACCCTGGGACATCTCCCTTGAAAATGTCGTTGCCAGTCAACTC
 
. : . : . : . : . : . :
rJMFF037L18- TGCAAACTTCTGGTCGTGTATTTTCTTTGTTGTTTTCACAACAGGTTCGTCACCAAACAT
rJMFF009D17- TGCAAACTTCTGGTCGTGTATTTTCTTTGTTGTTTTCACAACAGGTTCGTCACCAAACAT
JMFN003A10+ TGCAAACTTCTGGTCGTGTATTTTCTTTGTTGTTTTCACAACAGGTTCGTCACCAAACAT
rJMSF024B16- TGCAAACTTCTGGTCGTGTATTTTCTTTGTTGTTTTCACAACAGGTTCGTCACCAAACAT
rJMFF025J15- TGCAAACTTCTGGTCGTGTATTTTCTTTGTTGTTTTCACAACAGGTTCGTCACCAAACAT
JMFN040L15+ TGCAAACTTCTGGTCGTGTATTTTCTTGTGTTTTNNCACAACAGGTTCGTCACCAAACAT
rJMSF039H11- TGCAAACTTCTGGTCGTGTATTTTCTTTGTTGTTTTCACAACAGGTTCGTCACCAAACAT
                      ____________________________________________________________
consensus TGCAAACTTCTGGTCGTGTATTTTCTTTGTTGTTTTCACAACAGGTTCGTCACCAAACAT
 
. : . : . : . : . : . :
rJMFF037L18- GATATTGCTTTGGCCTCCAGCAGGATTAGAAACCTTGACAGACGTGCGGACATTACGAGG
rJMFF009D17- GATATTGCTTTGGCCTCCAGCAGGATTAGAAACCTTGACAGACGTGCGGACATTACGAGG
JMFN003A10+ GATATTGCTTTGGCCTCCAGCAGGATTAGAAACCTTGACAGACGTGCGGACATTACGAGG
rJMSF024B16- GATATTGCTTTGGCCTCCAGCAGGATTAGAAACCTTGACAGACGTGCGGACATTACGAGG
rJMFF025J15- GATATTGCTTTGGCCTCCAGCAGGATTAGAAACCTTGACAGACGTGCGGACATTACGAGG
JMFN040L15+ GATATTGCTTTGGCCTCCAGCAGGATTAGAAACCTTGACAGACGTGCGGACATTACGAGG
rJMSF039H11- GATATTGCTTTGGCCTCCAGCAGGATTAGAAACCTTGACAGACGTGCGGACATTACGAGG
JMSF024B16+ CAGACGTGCGGACATTACGAGG
                      ____________________________________________________________
consensus GATATTGCTTTGGCCTCCAGCAGGATTAGAAACCTTGACAGACGTGCGGACATTACGAGG
 
. : . : . : . : . : . :
rJMFF037L18- AGCAGGCTCACCCATAAAATTACTTTCTTTTGATTCCATTGAGCGCGCAACAGTCAATGA
rJMFF009D17- AGCAGGCTCACCCATAAAATTGCTTTCTTTTGATTCCATTGAGCGCGCAACAGTCAATGA
JMFN003A10+ AGCAGGCTCACCCATAAAATTGCTTTCTTTTGATTCCATTGAGCGCGCAACAGTCAATGA
rJMSF024B16- AGCAGGCTCACCCATAAAATTGCTTTCTTTTGATTCCATTGAGCGCGCAACAGTCAATGA
rJMFF025J15- AGCAGGCTCACCCATAAAATTGCTTTCTTTTGATTCCATTGAGCGCGCAACAGTCAATGA
JMFN040L15+ AGCAGGCTCACCCATAAAATTGCTTTCTTTTGATTCCATTGAGCGCGCAACAGTCAATGA
rJMSF039H11- AGCAGGCTCACCCATAAAATTGCTTTCTTTTGATTCCATTGAGCGCGCAACAGTCAATGA
JMFF037L18+ CATTGAGCGCGCAACAGTCAATGA
JMFN002D03+ TTTGATTCCATTGAGCGCGCAACAGTCAATGA
JMSF024B16+ AGCAGGCTCACCCATAAAATTGCTTTCTTTTGATTCCATTGAGCGCGCAACAGTCAATGA
JMFS043H12+ GCGCGCAACAGTCAATGA
                      ____________________________________________________________
consensus AGCAGGCTCACCCATAAAATTGCTTTCTTTTGATTCCATTGAGCGCGCAACAGTCAATGA
 
. : . : . : . : . : . :
rJMFF037L18- TCTA
rJMFF009D17- TCTAGGAGGAGCTTCAGAA
JMFN003A10+ TCTAGGAGGAGCTTCAGAAGGAGGACCAAATATGTCGTTTCCACTAAGTTCCTTGCACTT
rJMSF024B16- TCTAGGAGGAGCTTCAGAAGGAGGACCAAATATGTCGTTTCCACTAAGTTCCTTGCACTT
rJMFF025J15- TCTAGGAGGAGCTTCAGAAGGAGGACCAAATATGTCGTTTCCACTAAGTTCCTTGCACTT
JMFN040L15+ TCTAGGAGGAGCTTCAGAAGGAGGACCAAATATGTCGTTTCCACTAAGTTCCTTGCACTT
rJMSF039H11- TCTAGGAGGAGCTTCAGAAGGAGGACCAAATATGTCGTTTCCACTAAGTTCCTTGCACTT
JMFF037L18+ TCTAGGAGGAGCTTCAGAAGGAGGACCAAATATGTCGTTTCCACTAAGTTCCTTGCACTT
JMFN002D03+ TCTAGGAGGAGCTTCAGAAGGAGGACCAAATATGTCGTTTCCACTAAGTTCCTTGCACTT
JMSF024B16+ TCTAGGAGGAGCTTCAGAAGGAGGACCAAATATGTCGTTTCCACTAAGTTCCTTGCACTT
JMFS043H12+ TCTAGGAGGAGCTTCAGAAGGAGGACCAAATATGTCGTTTCCACTAAGTTCCTTGCACTT
JMFF050P24+ AAGTTCCTTGCACTT
                      ____________________________________________________________
consensus TCTAGGAGGAGCTTCAGAAGGAGGACCAAATATGTCGTTTCCACTAAGTTCCTTGCACTT
 
. : . : . : . : . : . :
JMFN003A10+ TGCATCTGACAGCTGCTTCTTGTTTTTGAGATCTGATTCACTTTCAAGAGTTCCACTC
rJMSF024B16- TGCATCTGACAGCTGCTTCTTGTTTTTGAGATCTGATTCACTTTCAAGAGTTCCACTCAA
rJMFF025J15- TGCATCTGACAGCTGCTTCTTGTTTTTGAGATCTGATTCACTTTCAAGAGTTCCACTCAA
JMFN040L15+ TGCATCTGACAGCTGCTTCTTGTTTTTGAGATCTGATTCACTTTCAAGAGTTCCACTCAA
rJMSF039H11- TGCATCTGACAGCTGCTTCTTGTTTTTGAGATCTGATTCACTTTCAAGAGTTCCACTCAA
JMFF037L18+ TGCATCTGACAGCTGCTTCTTGTTTTTGAGATCTGATTCACTTTCAAGAGTTCCACTCAA
JMFN002D03+ TGCATCTGACAGCTGCTTCTTGTTTTTGAGATCTGATTCACTTTCAAGAGTTCCACTCAA
JMSF024B16+ TGCATCTGACAGCTGCTTCTTGTTTTTGAGATCTGATTCACTTTCAAGAGTTCCACTCAA
JMFS043H12+ TGCATCTGACAGCTGCTTCTTGTTTTTGAGATCTGATTCACTTTCAAGAGTTCCACTCAA
JMFF009D17+ TGCATCTGACAGCTGCTTCTTGTTTTTGAGATCTGATTCACTTTCAAGAGTTCCACTCAA
JMFF050P24+ TGCATCTGACAGCTGCTTCTNGTTTTGNAGATCTGATTCACTTTCAAGAGTTCCACTCAA
JMSF039H11+ CTGACAGCTGCTTCTTGTTTTTGAGATCTGATTCACTTTCAAGAGTTCCACTCAA
                      ____________________________________________________________
consensus TGCATCTGACAGCTGCTTCTTGTTTTTGAGATCTGATTCACTTTCAAGAGTTCCACTCAA
 
. : . : . : . : . : . :
rJMSF024B16- TTCACGCTGTTTTGCCACCTCAGGTATAGTGGTAGGCTTTTTCGGGGAAATTTTTTCTTC
rJMFF025J15- TTCACGCTGTTTTGCCACCTCAGGTATAGTGGTAGGCTTTTTCGGGGAAATTTTTTCTTC
JMFN040L15+ TTCACGCTGTTTTGCCACCTCAGGTATAGTGGTAGGCTTTTTCGGGGAAATTTTTTCTTC
rJMSF039H11- TTCACGCTGTTTTGCCACCTCAGGTATAGTGGTAGGCTTTTTCGGGGAAATTTTTTCTTC
JMFF037L18+ TTCACGCTGTTTTGCCACCTCAGGTATAGTGGTAGGCTTTTTCGGGGAAATTTTTTCTTC
JMFN002D03+ TTCACGCTGTTTTGCCACCTCAGGTATAGTGGTAGGCTTTTTCGGGGAAATTTTTTCTTC
JMSF024B16+ TTCACGCTGTTTTGCCACCTCAGGTATAGTGGTAGGCTTTTTCGGGGAAATTTTTTCTTC
JMFS043H12+ TTCACGCTGTTTTGCCACCTCAGGTATAGTGGTAGGCTTTTTCGGGGAAATTTTTTCTTC
JMFF009D17+ TTCACGCTGTTTTGCCACCTCAGGTATAGTGGTAGGCTTTTTCGGGGAAATTTTTTCTTC
JMFF050P24+ TTCACGCTGTTTTGCCACCTCAGGTATAGTGGTAGGCTTTTTCGGGGAAATTTTTTCTTC
JMSF039H11+ TTCACGCTGTTTTGCCACCTCAGGTATAGTGGTAGGCTTTTTCGGGGAAATTTTTTCTTC
                      ____________________________________________________________
consensus TTCACGCTGTTTTGCCACCTCAGGTATAGTGGTAGGCTTTTTCGGGGAAATTTTTTCTTC
 
. : . : . : . : . : . :
rJMSF024B16- AGTACTGAATGAAATCTGGCTTATTCCATTCGCAGTTTGCTGAACTATACGCACTGATGT
rJMFF025J15- AGTACTGAATGAAATCTGGCTTATACCATTCGCAGTTTGCTGAACTATACGCACTGATGN
JMFN040L15+ AGTACTGAATGAAATCTGGCTTATTCCATTCGCAGTTTGCTGAACTATACGCACTGATGT
rJMSF039H11- AGTACTGAATGAAATCTGGCTTATTCCATTCGCAGTTTGCTGAACTATACGCACTGATGT
JMFF037L18+ AGTACTGAATGAAATCTGGCTTATTCCATTCGCAGTTTGCTGAACTATACGCACTGATGT
JMFN002D03+ AGTACTGAATGAAATCTGGCTTATTCCATTCGCAGTTTGCTGAACTATACGCACTGATGT
JMSF024B16+ AGTACTGAATGAAATCTGGCTTATTCCATTCGCAGTTTGCTGAACTATACGCACTGATGT
JMFS043H12+ AGTACTGAATGAAATCTGGCTTATTCCATTCGCAGTTTGCTGAACTATACGCACTGATGT
JMFF009D17+ AGTACTGAATGAAATCTGGCTTATTCCATTCGCAGTTTGCTGAACTATACGCACTGATGT
JMFF050P24+ AGTACTGAATGAAATCTGGCTTATTCCATTCGCAGTTTGCTGAACTATACGCACTGATGT
JMSF039H11+ AGTACTGAATGAAATCTGGCTTATTCCATTCGCAGTTTGCTGAACTATACGCACTGATGT
                      ____________________________________________________________
consensus AGTACTGAATGAAATCTGGCTTATTCCATTCGCAGTTTGCTGAACTATACGCACTGATGT
 
. : . : . : . : . : . :
rJMSF024B16- TCTATTACTC
rJMFF025J15- TCTATTACTCAAATTG
JMFN040L15+ TCTATTACTCAAATTGCCATTAGTTCCAGATTCTGAGGCATCATTCTCACTGTCAGCAGA
rJMSF039H11- TCTATTACTCAAATTGCCATTAGTTCCAGATTCTGAGGCATCATTCTCACTGTCAGCAGA
JMFF037L18+ TCTATTACTCAAATTGCCATTAGTTCCAGATTCTGAGGCATCATTCTCACTGTCAGCAGA
JMFN002D03+ TCTATTACTCAAATTGCCATTAGTTCCAGATTCTGAGGCATCATTCTCACTGTCAGCAGA
JMSF024B16+ TCTATTACTCAAATTGCCATTAGTTCCAGATTCTGAGGCATCATTCTCACTGTCAGCAGA
JMFS043H12+ TCTATTACTCAAATTGCCATTAGTTCCAGATTCTGAGGCATCATTCTCACTGTCAGCAGA
JMFF009D17+ TCTATTACTCAAATTGCCATTAGTTCCAGATTCTGAGGCATCATTCTCACTGTCAGCAGA
JMFF050P24+ TCTATTACTCAAATTGCCATTAGTTCCAGATTCTGAGGCATCATTCTCACTGTCAGCAGA
JMSF039H11+ TCTATTACTCAAATTGCCATTAGTTCCAGATTCTGAGGCATCATTCTCACTGTCAGCAGA
                      ____________________________________________________________
consensus TCTATTACTCAAATTGCCATTAGTTCCAGATTCTGAGGCATCATTCTCACTGTCAGCAGA
 
. : . : . : . : . : . :
JMFN040L15+ AAATATATTGCTGCCATTCATCTCCTTCAATTTATACCCTGAACAAGGTTTCC
rJMSF039H11- AAATATATTGCTGCCATTCATCTCCTTCAATTTATACCCTGAACAAGGNTTCCGTTTGTT
JMFF037L18+ AAATATATTGCTGCCATTCATCTCCTTCAATTTATACCCTGAACAAGGTTTCCGTTTGTT
JMFN002D03+ AAATATATTGCTGCCATTCATCTCCTTCAATTTATACCCTGAACAAGGTTTCCGTTTGTT
JMSF024B16+ AAATATATTGCTGCCATTCATCTCCTTCAATTTATACCCTGAACAAGGTTTCCGTTTGTT
JMFS043H12+ AAATATATTGCTGCCATTCATCTCCTTCAATTTATACCCTGAACAAGGTTTCCGTTTGTT
JMFF009D17+ AAATATATTGCTGCCATTCATCTCCTTCAATTTATACCCTGAACAAGGTTTCCGTTTGTT
JMFF050P24+ AAATATATTGCTGCCATTCATCTCCTTCAATTTATACCCTGAACAAGGTTTCCGTTTGTT
JMSF039H11+ AAATATATTGCTGCCATTCATCTCCTTCAATTTATACCCTGAACAAGGTTTCCGTTTGTT
                      ____________________________________________________________
consensus AAATATATTGCTGCCATTCATCTCCTTCAATTTATACCCTGAACAAGGTTTCCGTTTGTT
 
. : . : . : . : . : . :
rJMSF039H11- C
JMFF037L18+ CAGGCTCTGAGCTTCCTCATCAGTAATCTGACCTCCAAAGAGCACCTTGCCGACTCCGTC
JMFN002D03+ CAGGCTCTGAGCTTCCTCATCAGTAATCTGACCTCCAAAGAGCACCTTGCCGACTCCGTC
JMSF024B16+ CAGGCTCTGAGCTTCCTCATCAGTAATCTGACCTCCAAAGAGCACCTTGCCGACTCCGTC
JMFS043H12+ CAGGCTCTGAGCTTCCTCATCAGTAATCTGACCTCCAAAGAGCACCTTGCCGACTCCGTC
JMFF009D17+ CAGGCTCTGAGCTTCCTCATCAGTAATCTGACCTCCAAAGAGCACCTTGCCGACTCCGTC
JMFF050P24+ CAGGCTCTGAGCTTCCTCATCAGTAATCTGACCTCCAAAGAGCACCTTGCCGACTCCGTC
JMSF039H11+ CAGGCTCTGAGCTTCCTCATCAGTAATCTGACCTCCAAAGAGCACCTTGCCGACTCCGTC
                      ____________________________________________________________
consensus CAGGCTCTGAGCTTCCTCATCAGTAATCTGACCTCCAAAGAGCACCTTGCCGACTCCGTC
 
. : . : . : . : . : . :
JMFF037L18+ AGAAGGCTGATGAGAAGTACGGGAGGCGGAGCGAGAAGCGTTGCCGGCGGCGAGGGAGGA
JMFN002D03+ AGAAGGCTGATGAGAAGTACGGGAGGCGGAGCGAGAAGCGTTGCCGGCGGCGAGGGAGGA
JMSF024B16+ AGAAGGCTGATGAGAAGTACGGGAGGCGGAGCGAGAAGCGTTGCCGGCGGCGAGGGAGGA
JMFS043H12+ AGAAGGCTGATGAGAAGTACGGGAGGCGGAGCGAGAAGCGTTGCCGGCGGCGAGGGAGGA
JMFF009D17+ AGAAGGCTGATGAGAAGTACGGGAGGCGGAGCGAGAAGCGTTGCCGGCGGCGAGGGAGGA
JMFF050P24+ AGAAGGCTGATGAGAAGTACGGGAGGCGGAGCGAGAAGCGTTGCCGGCGGCGAGGGAGGA
JMSF039H11+ AGAAGGCTGATGAGAAGTACGGGAGGCGGAGCGAGAAGCGTTGCCGGCGGCGAGGGAGGA
                      ____________________________________________________________
consensus AGAAGGCTGATGAGAAGTACGGGAGGCGGAGCGAGAAGCGTTGCCGGCGGCGAGGGAGGA
 
. : . : . : . : . : . :
JMFF037L18+ GTCGGATGCCGGCGTCTCGGACCAGGTGAGTAGATCGGCGGTGGAAGTGTGCGGCTTCCG
JMFN002D03+ GTCGGATGCCGGCGTCTCGGACCAGGTGAGTAGATCGGCGGTGGAAGTGTGCGGCTTCCG
JMSF024B16+ GTCGGATGCCGGCGTCTCGGACCAGGTGAGTAGATCGGCGGTGGAAGTGTGCGGCTTCCG
JMFS043H12+ GTCGGATGCCGGCGTCTCGGACCAGGTGAGTAGATCGGCGGTGGAAGTGTGCGGCTTCCG
JMFF009D17+ GTCGGATGCCGGCGTCTCGGACCAGGTGAGTAGATCGGCGGTGGAAGTGTGCGGCTTCCG
JMFF050P24+ GTCGGATGCCGGCGTCTCGGACCAGGTGAGTAGATCGGCGGTGGAAGTGTGCGGCTTCCG
JMSF039H11+ GTCGGATGCCGGCGTCTCGGACCAGGTGAGTAGATCGGCGGTGGAAGTGTGCGGCTTCCG
                      ____________________________________________________________
consensus GTCGGATGCCGGCGTCTCGGACCAGGTGAGTAGATCGGCGGTGGAAGTGTGCGGCTTCCG
 
. : . : . : . : . : . :
JMFF037L18+ AACAGGCGTCGCTCTCTCCGCCATTGCTTT
JMFN002D03+ AACAGGCGTCGC
JMSF024B16+ AACAGGCGTCGCTCTCTCCGCCATTGCTTTGATGCTTGAGCTAATAGTATAGTGT
JMFS043H12+ AACAGGCGTCGCTCTCTCCGCCATTGCTTTGATGCTTGAGCTAATAGTATAGTGTG
JMFF009D17+ AACAGGCGTCGCTCTCTCCGCCATTGCTTTGATGCTTGAGCTAATAGTATAGTGTGTAGA
JMFF050P24+ AACAGGCGTCGCTCTCTCCGCCATTGCTTTGATGCTTGAGCTAATAGTATAGTGTGTAGA
JMSF039H11+ AACAGGCGTCGCTCTCTCCGCCATTGCTTTGATGCTTGAGCTAATAGTATAGTGTGTAGA
                      ____________________________________________________________
consensus AACAGGCGTCGCTCTCTCCGCCATTGCTTTGATGCTTGAGCTAATAGTATAGTGTGTAGA
 
. : . : . : . : . : . :
JMFF009D17+ TAAGAGCGGTGAAAGAT
JMFF050P24+ TAAGAGCGGTGAAAGATAGATTTAGTCTGCTTCTGCCTGTGAGTATGCTTTTATTTGAAA
JMSF039H11+ TAAGAGCGGTGAAAGATAGATTTAGTCTGCTTCTGCCTGTGAGTATGCTTTTATTTGAAA
                      ____________________________________________________________
consensus TAAGAGCGGTGAAAGATAGATTTAGTCTGCTTCTGCCTGTGAGTATGCTTTTATTTGAAA
 
. : . : . : . : . : . :
JMFF050P24+ ATTGAAACGCTACTTTGCTCTC
JMSF039H11+ ATTGAAACGCTACTTTGCTCTCTCTTCTCTTTCTCTCTCTCTCTTTATTTTTATGGGATC
                      ____________________________________________________________
consensus ATTGAAACGCTACTTTGCTCTCTCTTCTCTTTCTCTCTCTCTCTTTATTTTTATGGGATC