Previous Contig 007278:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF007D20Sequence410007278 (5)gb:AP002854_18231642e-21Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, BAC clone:OSJN370007278 (5)gb:AP002854_18231642e-21Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, BAC clone:OSJN
JMFN033D07Sequence569007278 (5)gb:AP002854_18231643e-22Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, BAC clone:OSJN
JMSF039F08Sequence485007278 (5)gb:AP002854_18231642e-22Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, BAC clone:OSJN436007278 (5)gb:AP002854_18231642e-22Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, BAC clone:OSJN

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN033D07+ TAATACTACTGTGTCTGCAACTGTGAAAGTAGATATTTTGTGCTCTTACAAT
                      ____________________________________________________________
consensus TAATACTACTGTGTCTGCAACTGTGAAAGTAGATATTTTGTGCTCTTACAAT
 
. : . : . : . : . : . :
JMFN033D07+ TGCAAAAAGATTTAGACTGACAAGTAATCAATGAAACAACCGAAGTATAAAAAAAAATCC
                      ____________________________________________________________
consensus TGCAAAAAGATTTAGACTGACAAGTAATCAATGAAACAACCGAAGTATAAAAAAAAATCC
 
. : . : . : . : . : . :
JMFN033D07+ ACATTCAGCGGGCACCTAAACAGTATTCATTAGAACAAATCTGTGACTTAATCACAATCA
                      ____________________________________________________________
consensus ACATTCAGCGGGCACCTAAACAGTATTCATTAGAACAAATCTGTGACTTAATCACAATCA
 
. : . : . : . : . : . :
JMFN033D07+ AACTTAAGTAGAGTTCAACACAAATCACCAAAATCCGGAAATATGTAGTTTACTAAAACA
                      ____________________________________________________________
consensus AACTTAAGTAGAGTTCAACACAAATCACCAAAATCCGGAAATATGTAGTTTACTAAAACA
 
. : . : . : . : . : . :
JMFN033D07+ ATCCATAATGCTATAATGTTAAAAACTAACCATCCTAATTCAAAACTCTTGCACCCTCAA
                      ____________________________________________________________
consensus ATCCATAATGCTATAATGTTAAAAACTAACCATCCTAATTCAAAACTCTTGCACCCTCAA
 
. : . : . : . : . : . :
JMFN033D07+ CACCACCATCTTCAATTACTTCATCTACTTCTCAGATGAGTTTGGTCCTCTCTTCTTTCC
rJMSF039F08- CTTCATCTACTTCTCAGATGAGTTTGGTCCTCTCTTCTTTCC
rJMFF007D20- CTTCATTTACTTCTCAGATGAGTTTGGCCCTCTCTTCTTACC
JMFF007D20+ CTTCATTTACTTCTCAGATGAGTTTGGCCCTCTCTTCTTACC
JMSF039F08+ CTTCATCTACTTCTCAGATGAGTTTGGTCCTCTCTTCTTTCC
                      ____________________________________________________________
consensus CACCACCATCTTCAATTACTTCATCTACTTCTCAGATGAGTTTGGTCCTCTCTTCTTTCC
 
. : . : . : . : . : . :
JMFN033D07+ GAAGCCAACAACGGCAGTGACGAAGCGGCGGTTGTACTGCATCCGCTTGTGAGCGCGGCC
rJMSF039F08- GAAGCCAACAACGGCAGTGACGAAGCGGCGGTTGTACTGCATCCGCTTGTGAGCGCGGCC
rJMFF007D20- AAAGCAAACAACGGCTGTAACAAAGCGGCGATTGTACTGCATCCGCTTATGAGCACGGCC
JMFF007D20+ AAAGCAAACAACGGCTGTAACAAAGCGGCGATTGTACTGCATCCGCTTATGAGCACGGCC
JMSF039F08+ GAAGCCAACAACGGCAGTGACGAAGCGGCGGTTGTACTGCATCCGCTTGTGAGCGCGGCC
                      ____________________________________________________________
consensus GAAGCCAACAACGGCAGTGACGAAGCGGCGGTTGTACTGCATCCGCTTGTGAGCGCGGCC
 
. : . : . : . : . : . :
JMFN033D07+ TCGGGGCTTCTTCTTCTTGTCCTGTTTAGCAACCTTCGGAGTTTGACCTCTTACCTTACC
rJMSF039F08- TCGGGGCTTCTTCTTCTTGTCCTGTTTAGCAACCTTCGGAGTTTGACCTCTCACCTTACC
rJMFF007D20- GCGGGGCTTCTTCTTCTTATCTTGCTTGGCAACCTTAGGAGTCTGCCCTCTCACCTTGCC
JMFF007D20+ GCGGGGCTTCTTCTTCTTATCTTGCTTGGCAACCTTAGGAGTCTGCCCTCTCACCTTGCC
JMSF039F08+ TCGGGGCTTCTTCTTCTTGTCCTGTTTAGCAACCTTCGGAGTTTGACCTCTCACCTTACC
                      ____________________________________________________________
consensus TCGGGGCTTCTTCTTCTTGTCCTGTTTAGCAACCTTCGGAGTTTGACCTCTCACCTTACC
 
. : . : . : . : . : . :
JMFN033D07+ GGCACGAGCCAAAGATCCATGAACCTTACCCAT
rJMSF039F08- GGCACGAGCCAAAGATCCATGAACCTTACCCATATTTGGTTTCTGAGATCGGCGGAGAGT
rJMFF007D20- GGCACGAGCCAAAGATCCGTGTACCTTACCCAT
JMFF007D20+ GGCACGAGCCAAAGATCCGTGTACCTTACCCAT
JMSF039F08+ GGCACGAGCCAAAGATCCATGAACCTTACCCATATTTGGTTTCTGAGATCGGCGGAGAGT
                      ____________________________________________________________
consensus GGCACGAGCCAAAGATCCATGAACCTTACCCATATTTGGTTTCTGAGATCGGCGGAGAGT
 
. : . : . : . : . : . :
rJMSF039F08- GCAGGGAAAACTTCGCCCTCTTCGACTGCTGGCTTGCCTCTAGCTTCCGAAAGGAATTCC
JMSF039F08+ GCAGGGAAAACTTCGCCCTCTTCGACTGCTGGCTTGCCTCTAGCTTCCGAAAGGAATTCC
                      ____________________________________________________________
consensus GCAGGGAAAACTTCGCCCTCTTCGACTGCTGGCTTGCCTCTAGCTTCCGAAAGGAATTCC