Previous Contig 007276:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFN038M04Sequence618007276 (4)pir|T48120|T481205e-74hypothetical protein F16M2.160 - Arabidopsis thaliana>gb:ATF16M2_1548856 Arabido
JMFS116H06Sequence563007276 (4)pir|T48120|T481203e-63hypothetical protein F16M2.160 - Arabidopsis thaliana>gb:ATF16M2_1548856 Arabido
JMSF039E24Sequence638007276 (4)pir|T48120|T481208e-62hypothetical protein F16M2.160 - Arabidopsis thaliana>gb:ATF16M2_1548856 Arabido894007276 (4)pir|E86161|E861615e-94F10O3.11 protein - Arabidopsis thaliana>gb:AE005172_889326 Arabidopsis thaliana

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF039E24- GG
                      ____________________________________________________________
consensus GG
 
. : . : . : . : . : . :
rJMSF039E24- CATCAATAGTGCATACAAATATACAAATATACAGNTTCAACAACGGTGCCACGAGCATCA
                      ____________________________________________________________
consensus CATCAATAGTGCATACAAATATACAAATATACAGNTTCAACAACGGTGCCACGAGCATCA
 
. : . : . : . : . : . :
rJMSF039E24- TTCAAAATAATCCATGATGGTTGGGAGAGAATAGAAAGAAAGCAATAACTGCACACTCTT
                      ____________________________________________________________
consensus TTCAAAATAATCCATGATGGTTGGGAGAGAATAGAAAGAAAGCAATAACTGCACACTCTT
 
. : . : . : . : . : . :
rJMSF039E24- CAACAGTTCAACTATCAGCAGCTCTAAAAACAGTCAAGAGGGATAGGAATAGGTTGATGA
                      ____________________________________________________________
consensus CAACAGTTCAACTATCAGCAGCTCTAAAAACAGTCAAGAGGGATAGGAATAGGTTGATGA
 
. : . : . : . : . : . :
rJMSF039E24- CATCAAGGTACAAGGCGACGGCGGCCCAGATATATTCATCGTAACTGTATCGCTTGATAA
                      ____________________________________________________________
consensus CATCAAGGTACAAGGCGACGGCGGCCCAGATATATTCATCGTAACTGTATCGCTTGATAA
 
. : . : . : . : . : . :
JMFN038M04+ ACGATGTACCCACAGAATACTATGGATGCCAGACAGCCATAGA
rJMSF039E24- GGTTATCCGTGTCATATACGATGTACCCACAGAATACTATGGATGCCAGACAGCCATAGA
                      ____________________________________________________________
consensus GGTTATCCGTGTCATATACGATGTACCCACAGAATACTATGGATGCCAGACAGCCATAGA
 
. : . : . : . : . : . :
JMFN038M04+ TCATCACTGAGATCTTCCCCATAGGAAAGAATATCTGGATCAGTGAAAACAGCATAAGCA
JMFS116H06+ CATAGGAAAGAATATCTGGATCAGTGAAAACAGCATAAGCA
rJMSF039E24- TCATCACTGAGATCTTCCCCATAGGAAAGAATATCTGGATCAGTGAAAACAGCATAAGCA
JMSF039E24+ CATAGGAAAGAATATCTGGATCAGTGAAAACAGCATAAGCA
                      ____________________________________________________________
consensus TCATCACTGAGATCTTCCCCATAGGAAAGAATATCTGGATCAGTGAAAACAGCATAAGCA
 
. : . : . : . : . : . :
JMFN038M04+ CCAGAATAGCACCGAACAAGAATGGTCCTAGGAAATTAAAATCCTGGCCTCTCTTTGCCG
JMFS116H06+ CCAGAATAGCACCGAACAAGAATGGTCCTAGGAAATTAAAATCCTGGCCTCTCTTTGCCG
rJMSF039E24- CCAGAATAGCACCGAACAAGAATGGTCCTAGGAAATTAAAATCCTGGCCTCTCTTTGCCG
JMSF039E24+ CCAGAATAGCACCGAACAAGAATGGTCCTAGGAAATTAAAATCCTGGCCTCTCTTTGCCG
                      ____________________________________________________________
consensus CCAGAATAGCACCGAACAAGAATGGTCCTAGGAAATTAAAATCCTGGCCTCTCTTTGCCG
 
. : . : . : . : . : . :
JMFN038M04+ CCCAGAATGTGTACAGAGTAAGAGCAATCACAACTGCAGCTGTTAAAATGGCTGCTTCTA
JMFS116H06+ CCCAGAATGTGTACAGAGTAAGAGCAATCACAACTGCAGCTGTTAAAATGGCTGCTTCTA
rJMSF039E24- CCCAGAATGTGTACAGAGTAAGAGCAATCACAACTGCAGCTGTTAAAATGGCTGCTTCTA
JMSF039E24+ CCCAGAATGTGTACAGAGTAAGAGCAATCACAACTGCAGCTGTTAAAATGGCTGCTTCTA
                      ____________________________________________________________
consensus CCCAGAATGTGTACAGAGTAAGAGCAATCACAACTGCAGCTGTTAAAATGGCTGCTTCTA
 
. : . : . : . : . : . :
JMFN038M04+ GGATCACTTTCCCACTAGTGTATGCACAAGTCAATCCGGTGGCGAAGGAAAGAGCCACCG
JMFS116H06+ GGATCACTTTCCCACTAGTGTATGCACAAGTCAATCCGGTGGCGAAGGAAAGAGCCACCG
rJMSF039E24- GGATCACTTTCCCACTAGTGTATGCACAAGTCAATCCGGTGGCGAAGGAAAGAGCCACCG
JMSF039E24+ GGATCACTTTCCCACTAGTGTATGCACAAGTCAATCCGGTGGCGAAGGAAAGAGCCACCG
                      ____________________________________________________________
consensus GGATCACTTTCCCACTAGTGTATGCACAAGTCAATCCGGTGGCGAAGGAAAGAGCCACCG
 
. : . : . : . : . : . :
JMFN038M04+ TGAAAATGCCAAGCAGTATATAGTTGTACGGATGCTTCTGGTGGTAGTAATACAACGGGC
JMFS116H06+ TGAAAATGCCAAGCAGTATATAGTTGTACGGATGCTTCTGGTGGTAGTAATACAACGGGC
rJMSF039E24- TGAAAATGCCAAGCAGTATATAGTTGTACGGATGCTTCTGGTGGTAGTAATACAACGGGC
JMSF039E24+ TGAAAATGCCAAGCAGTATATAGTTGTACGGATGCTTCTGGTGGTAGTAATACAACGGGC
                      ____________________________________________________________
consensus TGAAAATGCCAAGCAGTATATAGTTGTACGGATGCTTCTGGTGGTAGTAATACAACGGGC
 
. : . : . : . : . : . :
JMFN038M04+ ATAGCACAATGAAGGGCGTGATGATGAGAACAATATAGAGAGCCAAACCAGCGCCAGTAG
JMFS116H06+ ATAGCACAATGAAGGGCGTGATGATGAGAACAATATAGAGAGCCAAACCAGCGCCAGTAG
rJMSF039E24- ATAGCACAATGAAGGGCGTGATGATGAGAACAATATAGAGAGCCAAACCAGCGCCAGTAG
JMSF039E24+ ATAGCACAATGAAGGGCGTGATGATGAGAACAATATAGAGAGCCAAACCAGCGCCAGTAG
                      ____________________________________________________________
consensus ATAGCACAATGAAGGGCGTGATGATGAGAACAATATAGAGAGCCAAACCAGCGCCAGTAG
 
. : . : . : . : . : . :
JMFN038M04+ TTGCAAAGAAGCGAGAAATATGATGATTAGTGATGACGACGGCGCCGACGGCGATGGACA
JMFS116H06+ TTGCAAAGAAGCGAGAAATATGATGATTAGTGATGACGACGGCGCCGACGGCGATGGACA
rJMSF039E24- TTGCAAAGAAGCGAGAAATATGATGATTAGTGATGACGACGGCGCCGACGGCGATGGACA
JMSF039E24+ TTGCAAAGAAGCGAGAAATATGATGATTAGTGATGACGACGGCGCCGACGGCGATGGACA
                      ____________________________________________________________
consensus TTGCAAAGAAGCGAGAAATATGATGATTAGTGATGACGACGGCGCCGACGGCGATGGACA
 
. : . : . : . : . : . :
JMFN038M04+ AGACCAATTGGATGGCTACAATGGAATACACTTTCCGAATGAATGACCACCGGAGTTCCG
JMFS116H06+ AGACCAATTGGATGGCTACAATGGAATACACTTTCCGAATGAATGACCACCGGAGTTCCG
rJMSF039E24- AGACCAATTGGATGGCTACAATGGAATACACTTTCCGAATGAATGACCACCGGAGTTCCG
JMSF039E24+ AGACCAATTGGATGGCTACAATGGAATACACTTTCCGAATGAATGACCACCGGAGTTCCG
                      ____________________________________________________________
consensus AGACCAATTGGATGGCTACAATGGAATACACTTTCCGAATGAATGACCACCGGAGTTCCG
 
. : . : . : . : . : . :
JMFN038M04+ GATTCTCCAGCATCGTCGGATACAGCGGCGCCGACCC-GGACTCCTCGTCGCCTTTGTAC
JMFS116H06+ GATTCTCCAGCATCGTCGGATACAGCGGCGCCGACCC-GGACTCCTCGTCGCCTTTGTAC
rJMSF039E24- GATTCTCCAGCATCGTCGGATACAGCGGCGCCGACCCGGGACTCCTCGTCGCCTTTGTAC
JMSF039E24+ GATTCTCCAGCATCGTCGGATACAGCGGCGCCGACCC-GGACTCCTCGTCGCCTTTGTAC
                      ____________________________________________________________
consensus GATTCTCCAGCATCGTCGGATACAGCGGCGCCGACCC-GGACTCCTCGTCGCCTTTGTAC
 
. : . : . : . : . : . :
JMFN038M04+ GCATAGTTCCACATCTCTCCGATC-AAACCAATGTCT
JMFS116H06+ GCATAGTTCCACATCTCTCCGATC-AAACCAATGTCT
rJMSF039E24- GCATAGTTCCACATCTCTCCGATCAAAACCAATGTCTTCCCTCAATATTCCG
JMSF039E24+ GCATAGTTCCACATCTCTCCGATC-AAACCAATGTCTT-CCTCAATATTCCGATTACTTG
                      ____________________________________________________________
consensus GCATAGTTCCACATCTCTCCGATC-AAACCAATGTCTTCCCTCAATATTCCGATTACTTG
 
. : . : . : . : . : . :
JMSF039E24+ ACTTTGAAATGCGCGGAGCGGAGTGTATATATTTTGATTTTTGAGAAGTTGATCAGAGCC
                      ____________________________________________________________
consensus ACTTTGAAATGCGCGGAGCGGAGTGTATATATTTTGATTTTTGAGAAGTTGATCAGAGCC