Previous Contig 007266:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF007E11Sequence559007266 (9)gb:AE005172_8902862e-31Arabidopsis thaliana chromosome 1, top arm complete sequence.>gb:AC025417_153951752002434 (11)gb:AE005172_8902862e-49Arabidopsis thaliana chromosome 1, top arm complete sequence.>gb:AC025417_153951
JMFF008C21Sequence564007266 (9)gb:AY086095_15711539e-29Arabidopsis thaliana clone 21249 mRNA, complete sequence.724002434 (11)gb:AE005172_8902864e-63Arabidopsis thaliana chromosome 1, top arm complete sequence.>gb:AC025417_153951
JMFF012I23Sequence536007266 (9)gb:AY086095_15711533e-30Arabidopsis thaliana clone 21249 mRNA, complete sequence.732002434 (11)gb:AE005172_8902862e-46Arabidopsis thaliana chromosome 1, top arm complete sequence.>gb:AC025417_153951
JMFF012M22Sequence462007266 (9)gb:AY086095_15711539e-19Arabidopsis thaliana clone 21249 mRNA, complete sequence.574002434 (11)gb:AE005172_8902867e-34Arabidopsis thaliana chromosome 1, top arm complete sequence.>gb:AC025417_153951
JMFF013G20Sequence531007266 (9)gb:AY086095_15711536e-31Arabidopsis thaliana clone 21249 mRNA, complete sequence.799002434 (11)gb:AE005172_8902862e-59Arabidopsis thaliana chromosome 1, top arm complete sequence.>gb:AC025417_153951
JMFF023A24Sequence369007266 (9)740002434 (11)gb:AE005172_8902861e-46Arabidopsis thaliana chromosome 1, top arm complete sequence.>gb:AC025417_153951
JMFF040C18Sequence537007266 (9)gb:AY086095_15711539e-31Arabidopsis thaliana clone 21249 mRNA, complete sequence.734002434 (11)gb:AE005172_8902863e-48Arabidopsis thaliana chromosome 1, top arm complete sequence.>gb:AC025417_153951
JMFF050P15Sequence610007266 (9)gb:AY086095_15711535e-28Arabidopsis thaliana clone 21249 mRNA, complete sequence.568002434 (11)gb:AE005172_8902861e-30Arabidopsis thaliana chromosome 1, top arm complete sequence.>gb:AC025417_153951
JMSF039C14Sequence624007266 (9)gb:AE005172_8902861e-32Arabidopsis thaliana chromosome 1, top arm complete sequence.>gb:AC025417_153951844002434 (11)gb:AE005172_8902861e-63Arabidopsis thaliana chromosome 1, top arm complete sequence.>gb:AC025417_153951

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF007E11+ CCAAACGCNTCATCCGCNGATTGC
JMFF050P15+ AGTAGAAGAGTTCAAACCCTCGCCGCCTTTACCAAACGCTTCATCCGCCGATTGC
JMSF039C14+ CCAAACGCTTCATCCGCCGATTGC
                      ____________________________________________________________
consensus AGTAGAAGAGTTCAAACCCTCGCCGCCTTTACCAAACGCTTCATCCGCCGATTGC
 
. : . : . : . : . : . :
JMFF007E11+ CATNTCCGCCGCCTCCTCTTGCGATACTCCAGAGAAACAGACACCGCGTGCAGCACACAC
JMFF050P15+ CATCTCCGCCGCCTCCTCTTGCGATACTCCAGAGAAACAGACA-CGCGTGCAGCACACAC
JMFF008C21+ CAGAGAAACAGACACCGCGTGCAGCACACAC
JMFF040C18+ TGCGATACTCCAGAGAAACAGACACCGCGTGCAGCACACAC
JMFF013G20+ CTCCAGAGAAACAGACACCGCGTGCAGCACACAC
JMFF012I23+ GATACTCCAGAGAAACAGACACCGCGTGCAGCACACAC
JMSF039C14+ CATCTCCGCCGCCTCCTCTTGCGATACTCCAGAGAAACAGACACCGCGTGCAGCACACAC
                      ____________________________________________________________
consensus CATCTCCGCCGCCTCCTCTTGCGATACTCCAGAGAAACAGACACCGCGTGCAGCACACAC
 
. : . : . : . : . : . :
JMFF007E11+ TGCAATGCGTACCNTACAATCCAAAGCCTGAGCGGCAATTCCGGCTGCTCATCCCGGCTC
JMFF050P15+ TGCAATGCGTACCCTACAATCCAAAGCCTGAGCGGCAATTCCGGCTGCTCATCCCGGCTC
JMFF012M22+ GCAATTCCGGNTGCTCATCCCGGNTC
JMFF008C21+ TGCAATGCGTACCCTACAATCCAAAGCCTGAGCGGCAATTCCGGCTGCTCATCCCGGCTC
JMFF040C18+ TGCAATGCGTACCCTACAATCCAAAGCCTGAGCGGCAATTCCGGCTGCTCATCCCGGCTC
JMFF013G20+ TGCAATGCGTACCCTACAATCCAAAGCCTGAGCGGCAATTCCGGCTGCTCATCCCGGCTC
JMFF012I23+ TGCAATGCGTACCCTACAATCCAAAGCCTGAGCGGCAATTCCGGCTGCTCATCCCGGCTC
JMSF039C14+ TGCAATGCGTACCCTACAATCCAAAGCCTGAGCGGCAATTCCGGCTGCTCATCCCGGCTC
                      ____________________________________________________________
consensus TGCAATGCGTACCCTACAATCCAAAGCCTGAGCGGCAATTCCGGCTGCTCATCCCGGCTC
 
. : . : . : . : . : . :
JMFF007E11+ AACACTAGCACCGCGGCGG-CAATCAGCACGAACGCCAAGTTCCAAACGAGGTCGAGAAT
JMFF050P15+ AACACCAGCACCGCGGCGG-CAATCAGCACGAACGCCAAGTTCCAAACGAGGTCGAGAAT
JMFF012M22+ AACACCAGCACCGCGGCGG-CAATCAGCACGAACGCCAAGTTCCAAACGAGGTCGAGAAT
JMFF008C21+ AACACCAGCACCGCGGCGG-CAATCAGCACGAACGCCAAGTTCCAAACGAGGTCGAGAAT
JMFF040C18+ AACACCAGCACCGCGGCGG-CAATCAGCACGAACGCCAAGTTCCAAACGAGGTCGAGAAT
JMFF013G20+ AACACCAGCACCGCGGCGGCCAATCAGCACGAACGCCAAGTTCCAAACGAGGTCGAGAAT
JMFF012I23+ AACACCAGCACCGCGGCGG-CAATCAGCACGAACGCCAAGTTCCAAACGAGGTCGAGAAT
JMSF039C14+ AACACCAGCACCGCGGCGG-CAATCAGCACGAACGCCAAGTTCCAAACGAGGTCGAGAAT
                      ____________________________________________________________
consensus AACACCAGCACCGCGGCGG-CAATCAGCACGAACGCCAAGTTCCAAACGAGGTCGAGAAT
 
. : . : . : . : . : . :
JMFF007E11+ GACGACGGGCTTCGAGTACGCCCAATCGCTCTGCCGCTCGTCCATCTGCTCCGCCGCAGC
JMFF050P15+ GACGACGGGCTTCGAGTACGCCCAATCGCTCTGCCGCTCGTCCATCTGCTCCGCCGCAGC
JMFF012M22+ GACGACGGGCTTCGAGTACGCCCAATCGCTCTGCCGCTCGTCCATCTGCTCCGCCGCAGC
JMFF008C21+ GACGACGGGCTTCGAGTACGCCCAATCGCTCTGCCGCTCGTCCATCTGCTCCGCCGCAGC
JMFF040C18+ GACGACGGGCTTCGAGTACGCCCAATCGCTCTGCCGCTCGTCCATCTGCTCCGCCGCAGC
JMFF013G20+ GACGACGGGCTTCGAGTACGCCCAATCGCTCTGCCGCTCGTCCATCTGCTCCGCCGCAGC
JMFF012I23+ GACGACGGGCTTCGAGTACGCCCAATCGCTCTGCCGCTCGTCCATCTGCTCCGCCGCAGC
JMFF023A24+ GCTCCGCCGCAGC
JMSF039C14+ GACGACGGGCTTCGAGTACGCCCAATCGCTCTGCCGCTCGTCCATCTGCTCCGCCGCAGC
                      ____________________________________________________________
consensus GACGACGGGCTTCGAGTACGCCCAATCGCTCTGCCGCTCGTCCATCTGCTCCGCCGCAGC
 
. : . : . : . : . : . :
JMFF007E11+ CTGGCGCACCAGCGCCGACGGCTCCCGCATCACCATCCCGCGACTGCCGGCTCGCCGAAG
JMFF050P15+ CTGGCGCACCAGCGCCGACGGCTCCCGCATCACCATCCCGCGACTGCCGGCTCGCCGGAG
JMFF012M22+ CTGGCGCACCAGCGCCGACGGCTCCCGCATCACCATCCCGCGACTGCCGGCTCGCCGGAG
JMFF008C21+ CTGGCGCACCAGCGCCGACGGCTCCCGCATCACCATCCCGCGACTGCCGGCTCGCCGGAG
JMFF040C18+ CTGGCGCACCAGCGCCGACGGCTCCCGCATCACCATCCCGCGACTGCCGGCTCGCCGGAG
JMFF013G20+ CTGGCGCACCAGCGCCGACGGCTCCCGCATCACCATCCCGCGACTGCCGGCTCGCCGGAG
JMFF012I23+ CTGGCGCACCAGCGCCGACGGCTCCCGCATCACCATCCCGCGACTGCCGGCTCGCCGGAG
JMFF023A24+ CTGGCGCACCAGCGCCGACGGCT-CCGCATCACCATCCCGCGACTGCCGGCTCGCCGGAN
JMSF039C14+ CTGGCGCACCAGCGCCGACGGCTCCCGCATCACCATCCCGCGACTGCCGGCTCGCCGGAG
                      ____________________________________________________________
consensus CTGGCGCACCAGCGCCGACGGCTCCCGCATCACCATCCCGCGACTGCCGGCTCGCCGGAG
 
. : . : . : . : . : . :
JMFF007E11+ AACCCAGACGACGTCGCGGATGCTGTGTCGGCGCAGTGATGGGCGGGTTCCGGCATAGCC
JMFF050P15+ AACCCAGACGACGTCGCGGATGCTGTGTCGGCGCAGTGATGGGCGGGTTCCGGCATAGCC
JMFF012M22+ AACCCAGACGACGTCGCGGATGCTGTGTCGGCGCAGTGATGGGCGGGTTCCGGCATAGCC
JMFF008C21+ AACCCAGACGACGTCGCGGATGCTGTGTCGGCGCAGTGATGGGCGGGTTCCGGCATAGCC
JMFF040C18+ AACCCAGACGACGTCGCGGATGCTGTGTCGGCGCAGTGATGGGCGGGTTCCGGCATAGCC
JMFF013G20+ AACCCAGACGACGTCGCGGATGCTGTGTCGGCGCAGTGATGGGCGGGTTCCGGCATAGCC
JMFF012I23+ AACCCAGACGACGTCGCGGATGCTGTGTCGGCGCAGTGATGGGCGGGTTCCGGCATAGCC
JMFF023A24+ AACCCAGACGACGTCGCGGATGCTGTGTCGGCGCAGTGATGGGCGGGTTCCGGCATAGCC
JMSF039C14+ AACCCAGACGACGTCGCGGATGCTGTGTCGGCGCAGTGATGGGCGGGTTCCGGCATAGCC
                      ____________________________________________________________
consensus AACCCAGACGACGTCGCGGATGCTGTGTCGGCGCAGTGATGGGCGGGTTCCGGCATAGCC
 
. : . : . : . : . : . :
JMFF007E11+ ATCGGCAGCGGCGGGAGTCATTAAAGGTGAGTTGGTGTAAGTAGGTGAAAACATTTTCAG
JMFF050P15+ ATCGGCAGCGGCGGGAGTCATTAAAGGTGAGTTGGTGTAAGTAGGTGAAAACATTTTCAG
JMFF012M22+ ATCGGCAGCGGCGGGAGTCATTAAAGGTGAGTTGGTGTAAGTAGGTGAAAACATTTTCAG
JMFF008C21+ ATCGGCAGCGGCGGGAGTCATTAAAGGTGAGTTGGTGTAAGTAGGTGAAAACATTTTCAG
JMFF040C18+ ATCGGCAGCGGCGGGAGTCATTAAAGGTGAGTTGGTGTAAGTAGGTGAAAACATTTTCAG
JMFF013G20+ ATCGGCAGCGGCGGGAGTCATTAAAGGTGAGTTGGTGTAAGTAGGTGAAAACATTTTCAG
JMFF012I23+ ATCGGCAGCGGCGGGAGTCATTAAAGGTGAGTTGGTGTAAGTAGGTGAAAACATTTTCAG
JMFF023A24+ ATCGGCAGCGGCGGGAGTCATTAAAGGTGAGTTGGTGTAAGTAGGTGAAAACATTTTCAG
JMSF039C14+ ATCGGCAGCGGCGGGAGTCATTAAAGGTGAGTTGGTGTAAGTAGGTGAAAACATTTTCAG
                      ____________________________________________________________
consensus ATCGGCAGCGGCGGGAGTCATTAAAGGTGAGTTGGTGTAAGTAGGTGAAAACATTTTCAG
 
. : . : . : . : . : . :
JMFF007E11+ GCGAATTTTGGATACAGTAAAATGCAGTACAACAAGAATGGAAAGATTATGATCCAGTGG
JMFF050P15+ GCGAATTTTGGATACAGTAAAATGCAGTACAACAAGAATGGAAAGATTATGATCCAGTGG
JMFF012M22+ GCGAATTTTGGATACAGTAAAATGCAGTACAACAAGAATGGAAAGATTATGATCCAGTGG
JMFF008C21+ GCGAATTTTGGATACAGTAAAATGCAGTACAACAAGAATGGAAAGATTATGATCCAGTGG
JMFF040C18+ GCGAATTTTGGATACAGTAAAATGCAGTACAACAAGAATGGAAAGATTATGATCCAGTGG
JMFF013G20+ GCGAATTTTGGATACAGTAAAATGCAGTACAACAAGAATGGAAAGATTATGATCCAGTGG
JMFF012I23+ GCGAATTTTGGATACAGTAAAATGCAGTACAACAAGAATGGAAAGATTATGATCCAGTGG
JMFF023A24+ GCGAATTTTGGATACAGTAAAATGCAGTACAACAAGAATGGAAAGATTATGATCCAGTGG
JMSF039C14+ GCGAATTTTGGATACAGTAAAATGCAGTACAACAAGAATGGAAAGATTATGATCCAGTGG
                      ____________________________________________________________
consensus GCGAATTTTGGATACAGTAAAATGCAGTACAACAAGAATGGAAAGATTATGATCCAGTGG
 
. : . : . : . : . : . :
JMFF007E11+ AGTAGGCCGTACAGTAGCCAACTACTCCATGGTCGCAGGGAACAAGGAGATTGC
JMFF050P15+ AGTAGGCCGTACAGTAGCCAACTACTCCATGGTCGCAGGGAACAAGGAGATTGCAAGATT
JMFF012M22+ AGTAGGCCGTACAGTAGCCAACTACTCCATGGTCGCAGGGAACAAGGAGATTGCAAGATT
JMFF008C21+ AGTAGGCCGTACAGTAGCCAACTACTCCATGGTCGCAGGGAACAAGGAGATTGCAAGATT
JMFF040C18+ AGTAGGCCGTACAGTAGCCAACTACTCCATGGTCGCAGGGAACAAGGAGATTGCAAGATT
JMFF013G20+ AGTAGGCCGTACAGTAGCCAACTACTCCATGGTCGCAGGGAACAAGGAGATTGCAAGATT
JMFF012I23+ AGTAGGCCGTACAGTAGCCAACTACTCCATGGTCGCAGGGAACAAGGAGATTGCAAGATT
JMFF023A24+ AGTAGGCCGTACAGTAGCCAACTACTCCATGGTCGCAGGGAACAAGGAGATTGCAAGATT
JMSF039C14+ AGTAGGCCGTACAGTAGCCAACTACTCCATGGTCGCAGGGAACAAGGAGATTGCAAGATT
                      ____________________________________________________________
consensus AGTAGGCCGTACAGTAGCCAACTACTCCATGGTCGCAGGGAACAAGGAGATTGCAAGATT
 
. : . : . : . : . : . :
JMFF050P15+ GTTTCGGATATGAAAAT
JMFF012M22+ GTTTCGGATATGAAAAT
JMFF008C21+ GTTTCGGATATGAAAATGAGGGCTGAAATGAACAACGACACACAGATAGCAAAC
JMFF040C18+ GTTTCGGATATGAAAAT
JMFF013G20+ GTTTCGGATATGAAAAT
JMFF012I23+ GTTTCGGATATGAAAAT
JMFF023A24+ GTTTCGGATATGAAAATGAGGGCTGAAATGAACAACGACACACAGATAGCAAAC
JMSF039C14+ GTTTCGGATATGAAAATGAGGGCTGAAATGAACAACGACACACAGATAGCAAACACTACC
                      ____________________________________________________________
consensus GTTTCGGATATGAAAATGAGGGCTGAAATGAACAACGACACACAGATAGCAAACACTACC