Previous Contig 007265:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF039C12Sequence583007265 (2)sp|Q9ZPV5|YU20_ARATH1e-04Hypothetical UPF0120 protein At2g18220.>pir|G84561|G84561 hypothetical protein A851013871 (3)sp|Q9ZPV5|YU20_ARATH1e-48Hypothetical UPF0120 protein At2g18220.>pir|G84561|G84561 hypothetical protein A
JMSF050C04Sequence698007265 (2)gb:AC123513_11924101e-20Dictyostelium discoideum strain AX4 chromosome 2 map 2779865-2840915, *** SEQUEN712013871 (3)sp|Q9ZPV5|YU20_ARATH9e-26Hypothetical UPF0120 protein At2g18220.>pir|G84561|G84561 hypothetical protein A

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF050C04+ TTGATGTAGGG
                      ____________________________________________________________
consensus TTGATGTAGGG
 
. : . : . : . : . : . :
JMSF050C04+ TCAGCATCACTATCATCACCATAATGACAAGCAGAACGAAATGCTCTCACAAGAGAGCGG
                      ____________________________________________________________
consensus TCAGCATCACTATCATCACCATAATGACAAGCAGAACGAAATGCTCTCACAAGAGAGCGG
 
. : . : . : . : . : . :
JMSF050C04+ ATTGCCCCTATGTTTCTCTTTTCTCTAATCAAGTTACACCAAGAATCAACCATTTCACTA
                      ____________________________________________________________
consensus ATTGCCCCTATGTTTCTCTTTTCTCTAATCAAGTTACACCAAGAATCAACCATTTCACTA
 
. : . : . : . : . : . :
JMSF050C04+ GTAACTACATTTTTAACGGACTTATTCCATTGTTCCCTAGAAGCCTGCTCCATCTCAAGC
                      ____________________________________________________________
consensus GTAACTACATTTTTAACGGACTTATTCCATTGTTCCCTAGAAGCCTGCTCCATCTCAAGC
 
. : . : . : . : . : . :
JMSF050C04+ TCATCAGTTTCCTTCTCATCTTCCATTGCCTCATCATCGAGTTCAATTTCTTCATCATCA
JMSF039C12+ ATCTTCCATTGCCTCATCATCGAGTTCAATTTCTTCATCATCA
                      ____________________________________________________________
consensus TCATCAGTTTCCTTCTCATCTTCCATTGCCTCATCATCGAGTTCAATTTCTTCATCATCA
 
. : . : . : . : . : . :
JMSF050C04+ TCAATTTCCTCATCATTAAATTCAAGAAGCTCCTTGTCATGCTCTTTCAAGAATTCAAAG
JMSF039C12+ TCAATTTCCTCATCATTAAATTCAAGAAGCTCCTTGTCATGCTCTTTCAAGAATTCAAAG
                      ____________________________________________________________
consensus TCAATTTCCTCATCATTAAATTCAAGAAGCTCCTTGTCATGCTCTTTCAAGAATTCAAAG
 
. : . : . : . : . : . :
JMSF050C04+ AACTCCGGATCCTTTTCTTGGAGTCTCTCCAACTGTTCCATATGCTCTCTAGCCGTTTTC
JMSF039C12+ AACTCCGGATCCTTTTCTTGGAGTCTCTCCAACTGTTCCATATGCTCTCTAGCCGTTTTC
                      ____________________________________________________________
consensus AACTCCGGATCCTTTTCTTGGAGTCTCTCCAACTGTTCCATATGCTCTCTAGCCGTTTTC
 
. : . : . : . : . : . :
JMSF050C04+ TTTGATGTTGAGTCTGGCATAGTGTCAGTTTGGTTGTCTTCACCCTTGGGTTCCTTTTTA
JMSF039C12+ TTTGATGTTGAGTCTGGCATAGTGTCAGTTTGGTTGTCTTCACCCTTGGGTTCCTTTTTA
                      ____________________________________________________________
consensus TTTGATGTTGAGTCTGGCATAGTGTCAGTTTGGTTGTCTTCACCCTTGGGTTCCTTTTTA
 
. : . : . : . : . : . :
JMSF050C04+ CTTGATAGTTTAACTTTTCTCCTTGAACCCATTGAGGAAGAGATGGAAAGTGGGCGTCCT
JMSF039C12+ CTTGATAGTTTAACTTTTCTCCTTGAACCCATTGAGGAAGAGATGGAAAGTGGGCGTCCT
                      ____________________________________________________________
consensus CTTGATAGTTTAACTTTTCTCCTTGAACCCATTGAGGAAGAGATGGAAAGTGGGCGTCCT
 
. : . : . : . : . : . :
JMSF050C04+ TTTTCTTCAGCCAAACCAGGAAAATCCTAAGGCCCT
JMSF039C12+ TTTTCTTCAGCCAAACCAGGAAAATCCTAAGGCCCTAAGTGGTTTTGTAGGAATTCAAGT
                      ____________________________________________________________
consensus TTTTCTTCAGCCAAACCAGGAAAATCCTAAGGCCCTAAGTGGTTTTGTAGGAATTCAAGT
 
. : . : . : . : . : . :
JMSF039C12+ TTACACAACAAAAACCGACAGAATCGTATGTTTTACGGTTTCTTGATCCACACAAGGAAG
                      ____________________________________________________________
consensus TTACACAACAAAAACCGACAGAATCGTATGTTTTACGGTTTCTTGATCCACACAAGGAAG
 
. : . : . : . : . : . :
JMSF039C12+ TGAGGAACTCCGTTCAGAGACAGTTTCCGAGCTTCTCTAAGATATTGAGGAAAGTGGAGT
                      ____________________________________________________________
consensus TGAGGAACTCCGTTCAGAGACAGTTTCCGAGCTTCTCTAAGATATTGAGGAAAGTGGAGT
 
. : . : . : . : . : . :
JMSF039C12+ CACCAGCCGGAAGAAGCAGGAGCCAGTAACGTTGTTCCGGCAGACGTTGGCGAGAGAGAG
                      ____________________________________________________________
consensus CACCAGCCGGAAGAAGCAGGAGCCAGTAACGTTGTTCCGGCAGACGTTGGCGAGAGAGAG
 
. : . : . : . : . : . :
JMSF039C12+ AGAGCTTTGGACGACTGTGTTGTGGCTCGCCCGTTCAAGCAGGGGAGCTGCAGCAGCATC
                      ____________________________________________________________
consensus AGAGCTTTGGACGACTGTGTTGTGGCTCGCCCGTTCAAGCAGGGGAGCTGCAGCAGCATC