Previous Contig 007254:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFN015O06Sequence609007254 (4)gb:AC144455_17441019e-28Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBb0086G17, complet
JMFN040J19Sequence624007254 (4)gb:AC144455_17441012e-31Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBb0086G17, complet
JMSF038P12Sequence619007254 (4)gb:AC144455_17441018e-22Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBb0086G17, complet818007254 (4)gb:AC144455_17441012e-56Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBb0086G17, complet

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF038P12- AAAGCAGCTTGTCAATCTA
                      ____________________________________________________________
consensus AAAGCAGCTTGTCAATCTA
 
. : . : . : . : . : . :
rJMSF038P12- GTTTACTATGTACACAACCGCACAAAATGTTGTCTTAAGATTATTATCAAACGTTCAAAT
                      ____________________________________________________________
consensus GTTTACTATGTACACAACCGCACAAAATGTTGTCTTAAGATTATTATCAAACGTTCAAAT
 
. : . : . : . : . : . :
rJMSF038P12- CTATATGCACTCATTTGCATGGGGCGAGACAAATTTACAGGTTAACAGTTTGAAGCCTGA
                      ____________________________________________________________
consensus CTATATGCACTCATTTGCATGGGGCGAGACAAATTTACAGGTTAACAGTTTGAAGCCTGA
 
. : . : . : . : . : . :
rJMSF038P12- GAAGAGGTCGGCTGTGGCTTGCCAGACTCGTTCAGCGGTGTTGATTTCGACCCCAGATTG
                      ____________________________________________________________
consensus GAAGAGGTCGGCTGTGGCTTGCCAGACTCGTTCAGCGGTGTTGATTTCGACCCCAGATTG
 
. : . : . : . : . : . :
rJMSF038P12- CAATCAGCCTGCAATGATGCCAACCATGCATCTACCTGTATTCTGGAAGTACTGGAGCAC
                      ____________________________________________________________
consensus CAATCAGCCTGCAATGATGCCAACCATGCATCTACCTGTATTCTGGAAGTACTGGAGCAC
 
. : . : . : . : . : . :
rJMSF038P12- TCGTATCGCAACCCTTGACGGGTTAAAATATAAAAGCAATGCTGAGCTTCCTCACCTTCT
                      ____________________________________________________________
consensus TCGTATCGCAACCCTTGACGGGTTAAAATATAAAAGCAATGCTGAGCTTCCTCACCTTCT
 
. : . : . : . : . : . :
rJMSF038P12- CGTGTGAGACAAGGAAGTGGACCAACTTCAACAATATCTGACAGCATGGTGGAGTCCTGA
                      ____________________________________________________________
consensus CGTGTGAGACAAGGAAGTGGACCAACTTCAACAATATCTGACAGCATGGTGGAGTCCTGA
 
. : . : . : . : . : . :
rJMSF038P12- GGACTCAAATCAGTAGACAACATATACAGGTATAGACAAGATCCATGGAGGACAACAAAT
                      ____________________________________________________________
consensus GGACTCAAATCAGTAGACAACATATACAGGTATAGACAAGATCCATGGAGGACAACAAAT
 
. : . : . : . : . : . :
rJMSF038P12- CTAGGAACCCAGTCATCAACTTCAGCATCATCAAGTGGAGGAAGTTCTCCAGGTAATGCT
JMFN015O06+ ACCCAGTCATCAACTTCAGCATCATCAAGTGGAGGAAGTTCTCCAGGTAATGCT
JMSF038P12+ CAGCATCATCAAGTGGAGGAAGTTCTCCAGGTAATGCT
                      ____________________________________________________________
consensus CTAGGAACCCAGTCATCAACTTCAGCATCATCAAGTGGAGGAAGTTCTCCAGGTAATGCT
 
. : . : . : . : . : . :
rJMSF038P12- GCCCATCTCATTCTCATGTAAAGGTATCCAGAGAGACGAGCAGATCGTAATATCTCATCT
JMFN015O06+ GCCCATCTCATTCTCATGTAAAGGTATCCAGAGAGACGAGCAGATCGTAATATCTCATCT
JMSF038P12+ GCCCATCTCATTCTCATGTAAAGGTATCCAGAGAGACGAGCAGATCGTAATATCTCATCT
                      ____________________________________________________________
consensus GCCCATCTCATTCTCATGTAAAGGTATCCAGAGAGACGAGCAGATCGTAATATCTCATCT
 
. : . : . : . : . : . :
rJMSF038P12- ACATGTTCTAATTGAGCTTTCAAGTGCGACTCTCTTTCTTCTAAATCATTGATTTCAGAT
JMFN015O06+ ACATGTTCTAATTGAGCTTTCAAGTGCGACTCTCTTTCTTCTAAATCATTGATTTCAGAT
JMSF038P12+ ACATGTTCTAATTGAGCTTTCAAGTGCGACTCTCTTTCTTCTAAATCATTGATTTCAGAT
                      ____________________________________________________________
consensus ACATGTTCTAATTGAGCTTTCAAGTGCGACTCTCTTTCTTCTAAATCATTGATTTCAGAT
 
. : . : . : . : . : . :
rJMSF038P12- CGAAGAGACGCTACCTCTACTGCACTCAAAACCACCTTTTCCTGGCCATCTGTGTCAGCT
JMFN015O06+ CGAAGAGACGCTACCTCTACTGCACTCAAAACCACCTTTTCCTGGCCATCTGTGTCAGCT
JMFN040J19+ ACCTTTTCCTGGCCATCTGTGTCAGCT
JMSF038P12+ CGAAGAGACGCTACCTCTACTGCACTCAAAACCACCTTTTCCTGGCCATCTGTGTCAGCT
                      ____________________________________________________________
consensus CGAAGAGACGCTACCTCTACTGCACTCAAAACCACCTTTTCCTGGCCATCTGTGTCAGCT
 
. : . : . : . : . : . :
rJMSF038P12- ACCCAAGGCAATCTTCGTAAGCTCAGTAACCTCAGCATTGATACTGTGCTTTTTAACTTA
JMFN015O06+ ACCCAAGGCAATCTTCGTAAGCTCAGTAACCTCAGCATTGATACTGTGCTTTTTAACTTA
JMFN040J19+ ACCCAAGGCAATCTTCGTAAGCTCAGTAACCTCAGCATTGATACTGTGCTTTTTAACTTA
JMSF038P12+ ACCCAAGGCAATCTTCGTAAGCTCAGTAACCTCAGCATTGATACTGTGCTTTTTAACTTA
                      ____________________________________________________________
consensus ACCCAAGGCAATCTTCGTAAGCTCAGTAACCTCAGCATTGATACTGTGCTTTTTAACTTA
 
. : . : . : . : . : . :
rJMSF038P12- CTCCGGGTCCACGATCCGCTGCACGACCTATGCTAA
JMFN015O06+ CTCCGGGTCCACGATCCGCTGCACGACCTATGCTAATAAAAGACACAGGAGCTAAAAGAG
JMFN040J19+ CTCCGGGTCCACGATCCGCTGCACGACCTAT-------------------GCTAAAAGAG
JMSF038P12+ CTCCGGGTCCACGATCCGCTGCACGACCTAT-------------------GCTAAAAGAG
                      ____________________________________________________________
consensus CTCCGGGTCCACGATCCGCTGCACGACCTATGCTAA--------------GCTAAAAGAG
 
. : . : . : . : . : . :
JMFN015O06+ TTATCGTAGCTATTTCTCAAAGGCGTGGATACAGTTGGGGTTTGAGGAGAGTCTGCACCA
JMFN040J19+ TTATCGTAGCTATTTCTCAAAGGCGTGGATACAGTTGGGGTTTGAGGAGAGTCTGCACCA
JMSF038P12+ TTATCGTAGCTATTTCTCAAAGGCGTGGATACAGTTGGGGTTTGAGGAGAGTCTGCACCA
                      ____________________________________________________________
consensus TTATCGTAGCTATTTCTCAAAGGCGTGGATACAGTTGGGGTTTGAGGAGAGTCTGCACCA
 
. : . : . : . : . : . :
JMFN015O06+ GGCATTGAAGCTTGAAAATGGTCAGGGAAAACTTCTATTCCACGAGGACCATCGCCCATG
JMFN040J19+ GGCATTGAAGCTTGAAAATGGTCAGGGAAAACTTCTATTCCACGAGGACCATCGCCCATG
JMSF038P12+ GGCATTGAAGCTTGAAAATGGTCAGGGAAAACTTCTATTCCACGAGGACCATCGCCCATG
                      ____________________________________________________________
consensus GGCATTGAAGCTTGAAAATGGTCAGGGAAAACTTCTATTCCACGAGGACCATCGCCCATG
 
. : . : . : . : . : . :
JMFN015O06+ AAGCTAATGCTTACTTAGATACCTCTTCGGCGGTCTGTCGACGGGAAGAGTTTGTAGTTG
JMFN040J19+ AAGCTAATGCTTACTTAGATACCTCTTCGGCGGTCTGTCGACGGGAAGAGTTTGTAGTTG
JMSF038P12+ AAGCTAATGCTTACTTAGATACCTCTTCGGCGGTCTGTCGACGGGAAGAGTTTGTAGTTG
                      ____________________________________________________________
consensus AAGCTAATGCTTACTTAGATACCTCTTCGGCGGTCTGTCGACGGGAAGAGTTTGTAGTTG
 
. : . : . : . : . : . :
JMFN015O06+ AGAAGGAGAGCAGGTGATGAAGGTTCGTGTTGGGGGATTGCTGTTTCACGAGATGACAGA
JMFN040J19+ AGAAGGAGAGCAGGTGATGAAGGTTCGTGTTGGGGGATTGCTGTTTCACGAGATGACAGA
JMSF038P12+ AGAAGGAGAGCAGGTGATGAAGGTTCGTGTTGGGGGATTGCTGTTTCACGAGATGACAGA
                      ____________________________________________________________
consensus AGAAGGAGAGCAGGTGATGAAGGTTCGTGTTGGGGGATTGCTGTTTCACGAGATGACAGA
 
. : . : . : . : . : . :
JMFN015O06+ GCGAAAATGTA
JMFN040J19+ GCGAAAATGTA
JMSF038P12+ GCGAAAATGTACGAATGCAATGATATGTCAAGTTTGGTAAACCCCTAGACTAACAGCTTC
                      ____________________________________________________________
consensus GCGAAAATGTACGAATGCAATGATATGTCAAGTTTGGTAAACCCCTAGACTAACAGCTTC