Previous Contig 007244:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS085E03Sequence603007244 (2)pir|C84518|C845184e-22hypothetical protein At2g14530 [imported] - Arabidopsis thaliana>gb:AC006067_153
JMSF038M22Sequence652007244 (2)pir|C84518|C845185e-39hypothetical protein At2g14530 [imported] - Arabidopsis thaliana>gb:AC006067_153752023821pir|C84518|C845187e-67hypothetical protein At2g14530 [imported] - Arabidopsis thaliana>gb:AC006067_153

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF038M22+ TCAGGAAGGTAAAGCCACGATCAGCTCCAGCAGGACGCCACTTCTTCACTTC
                      ____________________________________________________________
consensus TCAGGAAGGTAAAGCCACGATCAGCTCCAGCAGGACGCCACTTCTTCACTTC
 
. : . : . : . : . : . :
JMSF038M22+ ACCAGACACTCCTTTCAAAGACAAAACAAGGAGACAAACATGTTCCTATTCAAGGAGTCA
                      ____________________________________________________________
consensus ACCAGACACTCCTTTCAAAGACAAAACAAGGAGACAAACATGTTCCTATTCAAGGAGTCA
 
. : . : . : . : . : . :
JMFS085E03+ CCAATATTGGTGTTTCTGAAGCGATCGAGGAATCGCAGAGCATCGAACTGA
JMSF038M22+ CCAACGAATCCAATATTGGTGTTTCTGAAGCGATCGAGGAATCGCAGAGCATCGAACTGA
                      ____________________________________________________________
consensus CCAACGAATCCAATATTGGTGTTTCTGAAGCGATCGAGGAATCGCAGAGCATCGAACTGA
 
. : . : . : . : . : . :
JMFS085E03+ GGGAGATCGCACCCGTAGGGTTTCCAGCGCCACTTGACGATATCGAGCGCATTATTTTTC
JMSF038M22+ GGGAGATCGCACCCGTAGGGTTTCCAGCGCCACTTGACGATATCGAGCGCATTATTTTTC
                      ____________________________________________________________
consensus GGGAGATCGCACCCGTAGGGTTTCCAGCGCCACTTGACGATATCGAGCGCATTATTTTTC
 
. : . : . : . : . : . :
JMFS085E03+ TTGCCCCCAATGCAATTCCATCCCTTGTATATCTCCTTGCAGGTATTATCGTAACGAGGA
JMSF038M22+ TTGCCCCCAATGCAATTCCATCCCTTGTATATCTCCTTGCAGGTATNATCGTAACGAGGA
                      ____________________________________________________________
consensus TTGCCCCCAATGCAATTCCATCCCTTGTATATCTCCTTGCAGGTATTATCGTAACGAGGA
 
. : . : . : . : . : . :
JMFS085E03+ GATTTGATTGTCCGATCGTAGATCCACCGGCCATCGGAAACATTGCACGACGGCGAGAAC
JMSF038M22+ GATTTGATTGTCCGATCGTAGATCCACCGGCCATCGGAAACATTGCACGACGGCGAGAAC
                      ____________________________________________________________
consensus GATTTGATTGTCCGATCGTAGATCCACCGGCCATCGGAAACATTGCACGACGGCGAGAAC
 
. : . : . : . : . : . :
JMFS085E03+ AATGCTTCCCGGTTTGTACTATGGTTGTTTTGAGCTGAGGAAGGAGCGGTCTTGAACAGA
JMSF038M22+ AATGCTTCCCGGTTTGTACTATGGTTGTTTTGAGCTGAGGAAGGAGCGGTCTTGAACAGA
                      ____________________________________________________________
consensus AATGCTTCCCGGTTTGTACTATGGTTGTTTTGAGCTGAGGAAGGAGCGGTCTTGAACAGA
 
. : . : . : . : . : . :
JMFS085E03+ GAGAAGCTTAAAAAGAGAGCGGCGAAGCAGATTATATAGAGAAATAGGGAAGAAGGGGAG
JMSF038M22+ GAGAAGCTTAAAAAGAGAGCGGCGAAGCAGATTATATAGAGAAATAGGGAAGAAGGGGAG
                      ____________________________________________________________
consensus GAGAAGCTTAAAAAGAGAGCGGCGAAGCAGATTATATAGAGAAATAGGGAAGAAGGGGAG
 
. : . : . : . : . : . :
JMFS085E03+ AAAAAGGAGGAAGATGAAGACGGTTGTTTCAGTTTCTTAGAAAGAGGGTGCATGGTGGTC
JMSF038M22+ AAAAAGGAGGAAGATGAAGACGGTTGTTTCAGTTTCTTAGAAAGAGGGTGCATGGTGGTC
                      ____________________________________________________________
consensus AAAAAGGAGGAAGATGAAGACGGTTGTTTCAGTTTCTTAGAAAGAGGGTGCATGGTGGTC
 
. : . : . : . : . : . :
JMFS085E03+ GGTTGCTCAGTCGGAGCTGTCGATCCGACCCGCCGGAATTCACTTCTCGCTTCCCTCGCA
JMSF038M22+ GGTTGCTCAGTCGGAGCTGTCGATCCGACCCGCCGGAATTCACTTCTCGCTTCCCTCGCA
                      ____________________________________________________________
consensus GGTTGCTCAGTCGGAGCTGTCGATCCGACCCGCCGGAATTCACTTCTCGCTTCCCTCGCA
 
. : . : . : . : . : . :
JMFS085E03+ CTATATTCATTCAACTCTCAAGATAAGAAACCAGATCAAGA
JMSF038M22+ CTATATTCATTCAACTCTCAAGATAAGAAACCAGATCAAGATCCGGCGGGTGAGATTTTC
                      ____________________________________________________________
consensus CTATATTCATTCAACTCTCAAGATAAGAAACCAGATCAAGATCCGGCGGGTGAGATTTTC