Previous Contig 007239:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF047B24Sequence620007239 (3)gb:AB020749_15146573e-33Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MRC8.>gb:BT008485_1639546010706 (3)gb:AP003144_18249122e-28Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P050
JMSF038D24Sequence710007239 (3)gb:AB020749_15146572e-48Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MRC8.>gb:BT008485_1639856010706 (3)gb:AP003144_18249126e-92Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P050
JMSF038L22Sequence623007239 (3)gb:AB020749_15146574e-32Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MRC8.>gb:BT008485_1639843010706 (3)gb:AP003144_18249121e-84Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P050

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF038D24+ TTTCACAGAAACGAGGCTGCAGCATCTCAAAGGTAAAAACCCCAGGAGAGG
                      ____________________________________________________________
consensus TTTCACAGAAACGAGGCTGCAGCATCTCAAAGGTAAAAACCCCAGGAGAGG
 
. : . : . : . : . : . :
JMFF047B24+ TCTGTGTTTTCATTGATTGCCTTGATAAACG
JMSF038D24+ GTTCAGACATTATATTTCGGAAACTGTCTTCTGTGTTTTCATTGATTGCCTTGATAAACG
JMSF038L22+ TTCATTGATTGCCNTGATAAACG
                      ____________________________________________________________
consensus GTTCAGACATTATATTTCGGAAACTGTCTTCTGTGTTTTCATTGATTGCCTTGATAAACG
 
. : . : . : . : . : . :
JMFF047B24+ AGGGCAGAAAGAAATTTGCAGCATGCATAGTATACAGATCCCTGTGCAAAGGCTGATAGT
JMSF038D24+ AGGGCAGAAAGAAATTTGCAGCATGCATAGTATACAGATCCCTGTGCAAAGGCTGATAGT
JMSF038L22+ AGGGCAGAAAGAAATTTGCAGCATGCATAGTATACAGATCCCTGTGCAAAGGCTGATAGT
                      ____________________________________________________________
consensus AGGGCAGAAAGAAATTTGCAGCATGCATAGTATACAGATCCCTGTGCAAAGGCTGATAGT
 
. : . : . : . : . : . :
JMFF047B24+ NTGATATAATCTTCTGCCTGTATTCTCTGTGCTTCTGGACGCGAGTTCGTTCGCCCTCCG
JMSF038D24+ TTGATATAATCTTCTGCCTGTATTCTCTGTGCTTCTGGACGCGAGTTCGTTCGCCCTCCG
JMSF038L22+ TTGATATAATCTTCTGCCTGTATTCTCTGTGCTTCTGGACGCGAGTTCGTTCGCCCTCCG
                      ____________________________________________________________
consensus TTGATATAATCTTCTGCCTGTATTCTCTGTGCTTCTGGACGCGAGTTCGTTCGCCCTCCG
 
. : . : . : . : . : . :
JMFF047B24+ GGGAGTACCTGAGGAGAATTTCCCGCATGTACTGAACCTTAGAATCACGGTTGGAGTTGA
JMSF038D24+ GGGAGTACCTGAGGAGAATTTCCCGCATGTACTGAACCTTAGAATCACGGTTGGAGTTGA
JMSF038L22+ GGGAGTACCTGAGGAGAATTTCCCGCATGTACTGAACCTTAGAATCACGGTTGGAGTTGA
                      ____________________________________________________________
consensus GGGAGTACCTGAGGAGAATTTCCCGCATGTACTGAACCTTAGAATCACGGTTGGAGTTGA
 
. : . : . : . : . : . :
JMFF047B24+ GGATGGTAGGCGGGAGATAGCGCTCCAGGGAGCTATACAGCAGCGGGCTGAAGTCCAATT
JMSF038D24+ GGATGGTAGGCGGGAGATAGCGCTCCAGGGAGCTATACAGCAGCGGGCTGAAGTCCAATT
JMSF038L22+ GGATGGTAGGCGGGAGATAGCGCTCCAGGGAGCTATACAGCAGCGGGCTGAAGTCCAATT
                      ____________________________________________________________
consensus GGATGGTAGGCGGGAGATAGCGCTCCAGGGAGCTATACAGCAGCGGGCTGAAGTCCAATT
 
. : . : . : . : . : . :
JMFF047B24+ GCAGGTCGTCATAGCTGTCGGACTTATGGTCCATACTCGGGTTCAGCCTCAACCTGTGAG
JMSF038D24+ GCAGGTCGTCATAGCTGTCGGACTTATGGTCCATACTCGGGTTCAGCCTCAACCTGTGAG
JMSF038L22+ GCAGGTCGTCATAGCTGTCGGACTTATGGTCCATACTCGGGTTCAGCCTCAACCTGTGAG
                      ____________________________________________________________
consensus GCAGGTCGTCATAGCTGTCGGACTTATGGTCCATACTCGGGTTCAGCCTCAACCTGTGAG
 
. : . : . : . : . : . :
JMFF047B24+ CAGTGTGAGTCTGGACAACGACGCCGTTCCCATTGCTCCCACTCCCATTCCCATTCCCGG
JMSF038D24+ CAGTGTGAGTCTGGACAACGACGCCGTTCCCATTGCTCCCACTCCCATTCCCATTCCCGG
JMSF038L22+ CAGTGTGAGTCTGGACAACGACGCCGTTCCCATTGCTCCCACTCCCATTCCCATTCCCGG
                      ____________________________________________________________
consensus CAGTGTGAGTCTGGACAACGACGCCGTTCCCATTGCTCCCACTCCCATTCCCATTCCCGG
 
. : . : . : . : . : . :
JMFF047B24+ CGGCCGTTCCCTGGCGGTCCTTGTCCCGATCCACTGCGGCCCCATCGAGAGACATCTGTG
JMSF038D24+ CGGCCGTTCCCTGGCGGTCCTTGTCCCGATCCACTGCGGCCCCATCGAGAGACATCTGTG
JMSF038L22+ CGGCCGTTCCCTGGCGGTCCTTGTCCCGATCCACTGCGGCCCCATCGAGAGACATCTGTG
                      ____________________________________________________________
consensus CGGCCGTTCCCTGGCGGTCCTTGTCCCGATCCACTGCGGCCCCATCGAGAGACATCTGTG
 
. : . : . : . : . : . :
JMFF047B24+ TAGATAGAGAACTCTGCGTATACGTATAGAGAGAGAGAGTCACGGTATGTGTATATCTAG
JMSF038D24+ TAGATAGAGAACTCTGCGTATACGTATAGAGAGAGAGAGTCACGGTATGTGTATATCTAG
JMSF038L22+ TAGATAGAGAACTCTGCGTATACGTATAGAGAGAGAGAGTCACGGTATGTGTATATCTAG
                      ____________________________________________________________
consensus TAGATAGAGAACTCTGCGTATACGTATAGAGAGAGAGAGTCACGGTATGTGTATATCTAG
 
. : . : . : . : . : . :
JMFF047B24+ AGAGATAAGGTTGATGTCAATGAGGTGAGTAGTATGACATGTTCGAAGGGAATGGATTTT
JMSF038D24+ AGAGATAAGGTTGATGTCAATGAGGTGAGTAGTATGACATGTTCGAAGGGAATGGATTTT
JMSF038L22+ AGAGATAAGGTTGATGTCAATGAGGTGAGTAGTATGACATGTTCGAAGGGAATGGATTTT
                      ____________________________________________________________
consensus AGAGATAAGGTTGATGTCAATGAGGTGAGTAGTATGACATGTTCGAAGGGAATGGATTTT
 
. : . : . : . : . : . :
JMFF047B24+ TAGGGTTTCAGGTTGGTTTGTTGTTGGTGAAGATGAAGGTTAGGGTTTG
JMSF038D24+ TAGGGTTTCAAGTTGGTTTGTTGTTGGTGAAGATGAAGGTTAGGGTTTGGTGTTTTAC
JMSF038L22+ TAGGGTTTCAGGTTGGTTTGTTGTTGGTGAAGATGAAGGTTAGGGTTTGGTGTTTTACCC
                      ____________________________________________________________
consensus TAGGGTTTCAGGTTGGTTTGTTGTTGGTGAAGATGAAGGTTAGGGTTTGGTGTTTTACCC