Previous Contig 007238:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF014G14Sequence498007238 (8)gb:AB011475_15113753e-20Arabidopsis thaliana genomic DNA, chromosome 5, TAC clone:K9L2.>gb:BT008551_1639760009958 (6)gb:AB011475_15113752e-86Arabidopsis thaliana genomic DNA, chromosome 5, TAC clone:K9L2.>gb:BT008551_1639
JMFF015I20Sequence584007238 (8)gb:AB011475_15113754e-18Arabidopsis thaliana genomic DNA, chromosome 5, TAC clone:K9L2.>gb:BT008551_1639734009958 (6)gb:AB011475_15113755e-70Arabidopsis thaliana genomic DNA, chromosome 5, TAC clone:K9L2.>gb:BT008551_1639
JMFF037L16Sequence521007238 (8)gb:AB011475_15113754e-24Arabidopsis thaliana genomic DNA, chromosome 5, TAC clone:K9L2.>gb:BT008551_1639701009958 (6)gb:AB011475_15113753e-67Arabidopsis thaliana genomic DNA, chromosome 5, TAC clone:K9L2.>gb:BT008551_1639
JMFF038G04Sequence499007238 (8)gb:AB011475_15113751e-23Arabidopsis thaliana genomic DNA, chromosome 5, TAC clone:K9L2.>gb:BT008551_1639791009958 (6)gb:AB011475_15113757e-84Arabidopsis thaliana genomic DNA, chromosome 5, TAC clone:K9L2.>gb:BT008551_1639
JMFF043I22Sequence616007238 (8)gb:AY065228_15663802e-29Arabidopsis thaliana putative translation initiation factor eIF3 (At4g20980) mRN572010325 (2)gb:AF291714_17837147e-38Arabidopsis thaliana initiation factor 3d mRNA, partial cds.
JMFS019B08Sequence551007238 (8)gb:AB011475_15113752e-22Arabidopsis thaliana genomic DNA, chromosome 5, TAC clone:K9L2.>gb:BT008551_1639
JMSF031F05Sequence671007238 (8)gb:AB011475_15113751e-36Arabidopsis thaliana genomic DNA, chromosome 5, TAC clone:K9L2.>gb:BT008551_1639791009958 (6)gb:AB011475_15113752e-93Arabidopsis thaliana genomic DNA, chromosome 5, TAC clone:K9L2.>gb:BT008551_1639
JMSF038L12Sequence659007238 (8)gb:AB011475_15113752e-29Arabidopsis thaliana genomic DNA, chromosome 5, TAC clone:K9L2.>gb:BT008551_1639958009958 (6)gb:AF291714_1783714e-117Arabidopsis thaliana initiation factor 3d mRNA, partial cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF043I22+ GAAGGTGGAGAAGGGGATC
JMSF031F05+ CGGAACAGAAAAGGAGAGCTTCGTGAAGGTGGAGAAGGGGATC
                      ____________________________________________________________
consensus CGGAACAGAAAAGGAGAGCTTCGTGAAGGTGGAGAAGGGGATC
 
. : . : . : . : . : . :
JMFS019B08+ AGACTCG
JMFF043I22+ TGGTCGAGCATATTCCACTCCGGTAGGATATCAACTGAGGACTTAAAGACTGCAGACTCG
JMSF031F05+ TGATCAAGCATGTTCCATTCTGGCTGGATATCGACGGAGGACTTGAACACCGAAGACTCG
JMFF015I20+ CG
JMSF038L12+ GGATATCGACGGAGGACTTGAACACCGAAGACTCG
                      ____________________________________________________________
consensus TGGTCGAGCATGTTCCATTCTGGTTGGATATCGACGGAGGACTTGAACACCGAAGACTCG
 
. : . : . : . : . : . :
JMFS019B08+ CGGCGTTGGCCGGCATTGATACCGGAGCGGTTGAGATTGTAGAG-CCTGTCACGGCGGGC
JMFF043I22+ CGGCGTTGGCCAGCATTGGTGCCGGAGCGATTGAG-GTGTAAAG-GCGGTCACGGCGAGC
JMSF031F05+ CGGCGTTGGCCGGCATTGATACCGGAGCGGTTGAGATTGTAGAG-CCTGTCACGGCGGGC
JMFF015I20+ CGGCGTTGGCCGGCATTGATACCGGAGCGGTTGAGATTGTAGAGCCCTGTCACGGCGGGC
JMSF038L12+ CGGCGTTGGCCGGCATTGATACCGGAGCGGTTGAGATTGTAGAG-CCTGTCACGGCGGGC
                      ____________________________________________________________
consensus CGGCGTTGGCCGGCATTGATACCGGAGCGGTTGAGATTGTAGAG-CCTGTCACGGCGGGC
 
. : . : . : . : . : . :
JMFS019B08+ TCGTTCCTTCTCGGCCTCGCGCTTGCGAGCCTCCACCTCCTCGTCACGGCGCTGAGGGAG
JMFF043I22+ ACGTTCCTTCTCTGCCTCGCGCTTGCGTGCCTCCACCTCCTCGTCTCGGCGCTGAGGGAG
JMSF031F05+ TCGTTCCTTCTCGGCCTCGCGCTTGCGAGCCTCCACCTCCTCGTCACGGCGCTGAGGGAG
JMFF038G04+ CTTGCGAGCCTCCACCTCCTCGTCACGGCGCTGAGGGAG
JMFF015I20+ TCGTTCCTTCTCGGCCTCGCGCTTGCGAGCCTCCACCTCCTCGTCACGGCGCTGAGGGAG
JMFF037L16+ CCTCGCGCTTGCGAGCCTCCACCTCCTCGTCACGGCGNTGAGGGAG
JMFF014G14+ CGTCACGGCGCTGAGGGAG
JMSF038L12+ TCGTTCCTTCTCGGCCTCGCGCTTGCGAGCCTCCACCTCCTCGTCACGGCGCTGAGGGAG
                      ____________________________________________________________
consensus TCGTTCCTTCTCGGCCTCGCGCTTGCGAGCCTCCACCTCCTCGTCACGGCGCTGAGGGAG
 
. : . : . : . : . : . :
JMFS019B08+ CTGAGAGCGCTGGTGGTGCGGATTGAATCGCCACCTAGGGTTGAACCTGGGACGGTGCTG
JMFF043I22+ CTGAGAGCGCTGGTGGTGGGGGTTAAAACGCCACCTTGGGTTGAATCTGGGGCGGTTCTG
JMSF031F05+ CTGAGAGCGCTGGTGGTGCGGATTGAATCGCCACCTAGGGTTGAACCTGGGACGGTGCTG
JMFF038G04+ CTGAGAGCGCTGGTGGTGCGGATTGAATCGCCACCTAGGGTTGAACCTGGGACGGTGCTG
JMFF015I20+ CTGAGAGCGCTGGTGGTGCGGATTGAATCGCCACCTAGGGTTGAACCTGGGACGGTGCTG
JMFF037L16+ CTGAGAGCGCTGGTGGTGCGGATTGAATCGCCACCTAGGGTTGAACCTGGGACGGTGCTG
JMFF014G14+ CTGAGAGCGCTGGTGGTGCGGATTGAATCGCCACCTAGGGTTGAACCTGGGACGGTGCTG
JMSF038L12+ CTGAGAGCGCTGGTGGTGCGGATTGAATCGCCACCTAGGGTTGAACCTGGGACGGTGCTG
                      ____________________________________________________________
consensus CTGAGAGCGCTGGTGGTGCGGATTGAATCGCCACCTAGGGTTGAACCTGGGACGGTGCTG
 
. : . : . : . : . : . :
JMFS019B08+ GCCGTGGTGGTGAGACTTCGCGGCCGTATCGACGAGGCGGAAGGAGGAATCCTCGTCGGC
JMFF043I22+ GCCGTGGTGGTGGGACTTGGCGGTGGTGTCCACCAAGCGGAAGGATGAATCCTCGTCGCC
JMSF031F05+ GCCGTGGTGGTGAGACTTCGCGGCCGTATCGACGAGGCGGAAGGAGGAATCCTCGTCGGC
JMFF038G04+ GCCGTGGTGGTGAGACTTCGCGGCCGTATCGACGAGGCGGAAGGAGGAATCCTCGTCGGC
JMFF015I20+ GCCGTGGTGGTGAGACTTCGCGGCCGTATCGACGAGGCGGAAGGAGGAATCCTCGTCGGC
JMFF037L16+ GCCGTGGTGGTGAGACTTCGCGGCCGTATCGACGAGGCGGAAGGAGGAATCCTCGTCGGC
JMFF014G14+ GCCGTGGTGGTGAGACTTCGCGGCCGTATCGACGAGGCGGAAGGAGGAATCCTCGTCGGC
JMSF038L12+ GCCGTGGTGGTGAGACTTCGCGGCCGTATCGACGAGGCGGAAGGAGGAATCCTCGTCGGC
                      ____________________________________________________________
consensus GCCGTGGTGGTGAGACTTCGCGGCCGTATCGACGAGGCGGAAGGAGGAATCCTCGTCGGC
 
. : . : . : . : . : . :
JMFS019B08+ GGCTAGCGTAGCGAAAGAGTCGTCAGTCGAGAAGTCGAACGCAGAGTCCGCGTGGCCCTG
JMFF043I22+ GGCTAGAGTGGCGAACGAATCGTCACCGGAGAAGTCGAAGGCAGAGTCCGC
JMSF031F05+ GGCTAGCGTAGCGAAAGAGTCGTCAGTCGAGAAGTCGAACGCAGAGTCCGCGTGGCCCTG
JMFF038G04+ GGCTAGCGTAGCGAAAGAGTCGTCAGTCGAGAAGTCGAACGCAGAGTCCGCGTGGCCCTG
JMFF015I20+ GGCTAGCGTAGCGAAAGAGTCGTCAGTCGAGAAGTCGAACGCAGAGTCCGCGTGGCCCTG
JMFF037L16+ GGCTAGCGTAGCGAAAGAGTCGTCAGTCGAGAAGTCGAACGCAGAGTCCGCGTGGCCCTG
JMFF014G14+ GGCTAGCGTAGCGAAAGAGTCGTCAGTCGAGAAGTCGAACGCAGAGTCCGCGTGGCCCTG
JMSF038L12+ GGCTAGCGTAGCGAAAGAGTCGTCAGTCGAGAAGTCGAACGCAGAGTCCGCGTGGCCCTG
                      ____________________________________________________________
consensus GGCTAGCGTAGCGAAAGAGTCGTCAGTCGAGAAGTCGAACGCAGAGTCCGCGTGGCCCTG
 
. : . : . : . : . : . :
JMFS019B08+ CTTCGAGTTCGCACCGGGCCGGCCCGGGTTCGACAGAGTCCGAGTCCAATCGGCGATTCT
JMSF031F05+ CTTCGAGTTCGCACCGGGCCGGCCCGGGTTCGACAGAGTCCGAGTCCAATCGGCGATTCT
JMFF038G04+ CTTCGAGTTCGCACCGGGCCGGCCCGGGTTCGACAGAGTCCGAGTCCAATCGGCGATTCT
JMFF015I20+ CTTCGAGTTCGCACCGGGCCGGCCCGGGTTCGACAGAGTCCGAGTCCAATCGGCGATTCT
JMFF037L16+ CTTCGAGTTCGCACCGGGCCGGCCCGGGTTCGACAGAGTCCGAGTCCAATCGGCGATTCT
JMFF014G14+ CTTCGAGTTCGCACCGGGCCGGCCCGGGTTCGACAGAGTCCGAGTCCAATCGGCGATTCT
JMSF038L12+ CTTCGAGTTCGCACCGGGCCGGCCCGGGTTCGACAGAGTCCGAGTCCAATCGGCGATTCT
                      ____________________________________________________________
consensus CTTCGAGTTCGCACCGGGCCGGCCCGGGTTCGACAGAGTCCGAGTCCAATCGGCGATTCT
 
. : . : . : . : . : . :
JMFS019B08+ CCCAATCCTCTCCGAGCGGGAGAAGGGAGCGAACGGCACATTGGAAGGCTGGTTAGGGAG
JMSF031F05+ CCCAATCCTCTCCGAGCGGGAGAAGGGAGCGAACGGCACATTGGAAGGCTGGTTAGGGAG
JMFF038G04+ CCCAATCCTCTCCGAGCGGGAGAAGGGAGCGAACGGCACATTGGAAGGCTGGTTAGGGAG
JMFF015I20+ CCCAATCCTCTCCGAGCGGGAGAAGGGAGCGAACGGCACATTGGAAGGCTGGTTAGGGAG
JMFF037L16+ CCCAATCCTCTCCGAGCGGGAGAAGGGAGCGAACGGCACATTGGAAGGCTGGTTAGGGAG
JMFF014G14+ CCCAATCCTCTCCGAGCGGGAGAAGGGAGCGAACGGCACATTGGAAGGCTGGTTAGGGAG
JMSF038L12+ CCCAATCCTCTCCGAGCGGGAGAAGGGAGCGAACGGCACATTGGAAGGCTGGTTAGGGAG
                      ____________________________________________________________
consensus CCCAATCCTCTCCGAGCGGGAGAAGGGAGCGAACGGCACATTGGAAGGCTGGTTAGGGAG
 
. : . : . : . : . : . :
JMFS019B08+ GGAGATCGAGCCGCCGGTGCTCGAATCCGGTGGGCCCCATCCGTCTGGGTTGAACGGTAC
JMSF031F05+ GGAGATCGAGCCGCCGGTGCTCGAATCCGGTGGGCCCCATCCGTCTGGGTTGAACGGTAC
JMFF038G04+ GGAGATCGAGCCGCCGGTGCTCGAATCCGGTGGGCCCCATCCGTCTGGGTTGAACGGTAC
JMFF015I20+ GGAGATCGAGCCGCCGGTGCTCGAATCCGGTGGGCCCCATCCGTCTGGGTTGAACGGTAC
JMFF037L16+ GGAGATCGAGCCGCCGGTGCTCGAATCCGGTGGGCCCCATCCGTCTGGGTTGAACGGTAC
JMFF014G14+ GGAGATCGAGCCGCCGGTGCTCGAATCCGGTGGGCCCCATCCGTCTGGGTTGAACGGTAC
JMSF038L12+ GGAGATCGAGCCGCCGGTGCTCGAATCCGGTGGGCCCCATCCGTCTGGGTTGAACGGTAC
                      ____________________________________________________________
consensus GGAGATCGAGCCGCCGGTGCTCGAATCCGGTGGGCCCCATCCGTCTGGGTTGAACGGTAC
 
. : . : . : . : . : . :
JMFS019B08+ TGCGCCGATTTCAAAGCCAACCATATTCCGATCAGATTCGAATTGTTCT
JMSF031F05+ TGCGCCGATTTCAAAGCCAACCATATTCCGATCAGATTCGAATTGTTCTTCCTTTTTTGG
JMFF038G04+ TGCGCCGATTTCAAAGCCAACCATATTCCGATCAGATTCGAATTGTTCTTCCTTTTTTGG
JMFF015I20+ TGCGCCGATTTCAAAGCCAACCATATTCCGATCAGATTCGAATTGTTCTTCCTTTTTTGG
JMFF037L16+ TGCGCCGATTTCAAAGCCAACCATATTCCGATCAGATTCGAATTGTTCTTCCTTTTTTGG
JMFF014G14+ TGCGCCGATTTCAAAGCCAACCATATTCCGATCAGATTCGAATTGTTCTTCCTTTTTTGG
JMSF038L12+ TGCGCCGATTTCAAAGCCAACCATATTCCGATCAGATTCGAATTGTTCTTCCTTTTTTGG
                      ____________________________________________________________
consensus TGCGCCGATTTCAAAGCCAACCATATTCCGATCAGATTCGAATTGTTCTTCCTTTTTTGG
 
. : . : . : . : . : . :
JMSF031F05+ TGATTGTAGCGCAGAGACCAGAGAGAGT
JMFF038G04+ TGATTGTAGCGCAGAGACCAGAGAGAGTGAGGAAGA
JMFF015I20+ TGATTGTAGCGCAGAGACCAGAGAGAGTGAGGAAGACGAT
JMFF037L16+ TGATTGTAGCGCAGAGACCAGAGAGAGTGAGGAAGACGATGATAAAACCCTA
JMFF014G14+ TGATTGTAGCGCAGAGACCAGAGAGAGTGAGGAAGACGATGATAAAACCCTA
JMSF038L12+ TGATTGTAGCGCAGAGACCAGAGAGAGTGAGGAAGACGATGATAAAACCCTAGCTACCTC
                      ____________________________________________________________
consensus TGATTGTAGCGCAGAGACCAGAGAGAGTGAGGAAGACGATGATAAAACCCTAGCTACCTC