Previous Contig 007234:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF018G22Sequence426007234 (2)
JMSF038L02Sequence644007234 (2)875023816gb:AY039605_15603181e-25Arabidopsis thaliana AT3g50910/F18B3_190 mRNA, complete cds.>gb:BT003021_1636603

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF038L02+ GCGCCCTCGAATTCCTCGATTCCATCTCCGGCCACCTCCGTATG
                      ____________________________________________________________
consensus GCGCCCTCGAATTCCTCGATTCCATCTCCGGCCACCTCCGTATG
 
. : . : . : . : . : . :
JMSF038L02+ CCCGCCAATTTTATCCTTCACCAAGTCCTCCTCCTTCTCCTGTTCATTTTCACCATGATA
                      ____________________________________________________________
consensus CCCGCCAATTTTATCCTTCACCAAGTCCTCCTCCTTCTCCTGTTCATTTTCACCATGATA
 
. : . : . : . : . : . :
JMSF038L02+ ATTCAATTCAATCCCAGCCTTCTCCTCCTCACCACATTTCTGCACTTCCGGAACCTGAAA
                      ____________________________________________________________
consensus ATTCAATTCAATCCCAGCCTTCTCCTCCTCACCACATTTCTGCACTTCCGGAACCTGAAA
 
. : . : . : . : . : . :
JMSF018G22+ CTCCACGCCGCTTGTGGTTAACGACATA
JMSF038L02+ TCCATCGATTTTCCCGTTCACGCGACGTTCTCCTCCACGCCGCTTGTGGTTAACGACATA
                      ____________________________________________________________
consensus TCCATCGATTTTCCCGTTCACGCGACGTTCTCCTCCACGCCGCTTGTGGTTAACGACATA
 
. : . : . : . : . : . :
JMSF018G22+ CGGAGACGGTGAGAGCGGTGCGGAGGAAAGCTCGGGGATCGGAGCTGATACCGGAGTTAT
JMSF038L02+ CGGAGACGGTGAGAGCGGTGCGGAGGAAAGCTCGGGGATCGGAGCTGATACCGGAGTTAT
                      ____________________________________________________________
consensus CGGAGACGGTGAGAGCGGTGCGGAGGAAAGCTCGGGGATCGGAGCTGATACCGGAGTTAT
 
. : . : . : . : . : . :
JMSF018G22+ ATACAGAGCCGGAGAAATGTAAACATGATTGGCAGAATGAGGCTTGGAATCAACCACTTC
JMSF038L02+ ATACAGAGCCGGAGAAATGTAAACATGATTGGCAGAATGAGGCTTGGAATCAACCACTTC
                      ____________________________________________________________
consensus ATACAGAGCCGGAGAAATGTAAACATGATTGGCAGAATGAGGCTTGGAATCAACCACTTC
 
. : . : . : . : . : . :
JMSF018G22+ CTCCCTCCGAGCACCATTATACGCGCCACCGTTACCGGTGCTCTTATTGGTATAACGCGC
JMSF038L02+ CTCCCTCCGAGCACCATTATACGCGCCACCGTTACCGGTGCTCTTATTGGTATAACGCGC
                      ____________________________________________________________
consensus CTCCCTCCGAGCACCATTATACGCGCCACCGTTACCGGTGCTCTTATTGGTATAACGCGC
 
. : . : . : . : . : . :
JMSF018G22+ CTGCGGTTTGGTGGCGAATTTCTGGAAACCGAATGGCGATTTGTAGGTATCTCGATCGCG
JMSF038L02+ CTGCGGTTTGGTGGCGAATTTCTGGAAACCGAATGGCGATTTGTAGGTATCTCGATCGCG
                      ____________________________________________________________
consensus CTGCGGTTTGGTGGCGAATTTCTGGAAACCGAATGGCGATTTGTAGGTATCTCGATCGCG
 
. : . : . : . : . : . :
JMSF018G22+ AGGCTCGATAAGATTCTCTAGGGCGATGGTCGTGAAAGTAGGCATGTTGGCCGGCGGCAG
JMSF038L02+ AGGCTCGATAAGATTCTCTAGGGCGATGGTCGTGAAAGTAGGCATGTTGGCCGGCGGCAG
                      ____________________________________________________________
consensus AGGCTCGATAAGATTCTCTAGGGCGATGGTCGTGAAAGTAGGCATGTTGGCCGGCGGCAG
 
. : . : . : . : . : . :
JMSF018G22+ AGATCAGAAAATGGTGAAATTTGTGGCGGCGGAGACGGAGGCGAAAGAGAGACGAGGCGG
JMSF038L02+ AGATCAGAAAATGGTGAAATTTGTGGCGGCGGAGACGGAGGCGAAAGAGAGACGAGGCGG
                      ____________________________________________________________
consensus AGATCAGAAAATGGTGAAATTTGTGGCGGCGGAGACGGAGGCGAAAGAGAGACGAGGCGG
 
. : . : . : . : . : . :
JMSF018G22+ GAAGGTGGAGGGAGAGTTTTGGAATGTGGTGAATGGCC
JMSF038L02+ GAAGGTGGAGGGAGAGTTTTGGAATGTGGTGAATGGCCGTGTGATTCTCCACCCACTCTC
                      ____________________________________________________________
consensus GAAGGTGGAGGGAGAGTTTTGGAATGTGGTGAATGGCCGTGTGATTCTCCACCCACTCTC