Previous Contig 007232:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF027C02Sequence686007232 (4)pir|B84581|B845813e-73probable clathrin assembly protein [imported] - Arabidopsis thaliana>gb:AC005169712007232 (4)pir|B84581|B845813e-73probable clathrin assembly protein [imported] - Arabidopsis thaliana>gb:AC005169
JMSF038K11Sequence678007232 (4)pir|B84581|B845813e-73probable clathrin assembly protein [imported] - Arabidopsis thaliana>gb:AC005169668007232 (4)pir|B84581|B845813e-73probable clathrin assembly protein [imported] - Arabidopsis thaliana>gb:AC005169

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF027C02- GAGAATCGTCTAGCTCCCAGCTGAAGTAG
                      ____________________________________________________________
consensus GAGAATCGTCTAGCTCCCAGCTGAAGTAG
 
. : . : . : . : . : . :
JMSF027C02- GATTGAATTTACCAACGTTGTTCAAACTCGTGATTTTCGACCTTCTCGATACGAGTATAC
rJMSF027C02+ CTCGATACGAGTATAC
                      ____________________________________________________________
consensus GATTGAATTTACCAACGTTGTTCAAACTCGTGATTTTCGACCTTCTCGATACGAGTATAC
 
. : . : . : . : . : . :
JMSF027C02- GATCGATCATATATATATATATACGGAGTATATAATATTTGATAGCCGAACCGAGCGAGT
rJMSF027C02+ GATCGATCATATATATATATATACGGAGTATATAATATTTGATAGCCGAACCGAGCGAGT
rJMSF038K11+ AGCCGAACCGAGCGAGT
JMSF038K11- AGCCGAACCGAGCGAGT
                      ____________________________________________________________
consensus GATCGATCATATATATATATATACGGAGTATATAATATTTGATAGCCGAACCGAGCGAGT
 
. : . : . : . : . : . :
JMSF027C02- GAAGGGGTGGTGAATCGGGGAGATCGCGTTGAGAGAAAGGAAGGAAGAAGGAGATGGGGA
rJMSF027C02+ GAAGGGGTGGTGAATCGGGGAGATCGCGTTGAGAGAAAGGAAGGAAGAAGGAGATGGGGA
rJMSF038K11+ GAAGGGGTGGTGAATCGGGGAGATCGCGTTGAGAGAAAGGAAGGAAGAAGGAGATGGGGA
JMSF038K11- GAAGGGGTGGTGAATCGGGGAGATCGCGTTGAGAGAAAGGAAGGAAGAAGGAGATGGGGA
                      ____________________________________________________________
consensus GAAGGGGTGGTGAATCGGGGAGATCGCGTTGAGAGAAAGGAAGGAAGAAGGAGATGGGGA
 
. : . : . : . : . : . :
JMSF027C02- TCAGATTCATACTAATGGTGAACAAGCAAGGGCAGACTCGGCTAGCCCAGTACTACGAGT
rJMSF027C02+ TCAGATTCATACTAATGGTGAACAAGCAAGGGCAGACTCGGCTAGCCCAGTACTACGAGT
rJMSF038K11+ TCAGATTCATACTAATGGTGAACAAGCAAGGGCAGACTCGGCTAGCCCAGTACTACGAGT
JMSF038K11- TCAGATTCATACTAATGGTGAACAAGCAAGGGCAGACTCGGCTAGCCCAGTACTACGAGT
                      ____________________________________________________________
consensus TCAGATTCATACTAATGGTGAACAAGCAAGGGCAGACTCGGCTAGCCCAGTACTACGAGT
 
. : . : . : . : . : . :
JMSF027C02- ACCTCACCATCGAAGAAAGGCGTGCGCTTGAGGGCGAAATCGTTCGCAAGTGTCTCGCGC
rJMSF027C02+ ACCTCACCATCGAAGAAAGGCGTGCGCTTGAGGGCGAAATCGTTCGCAAGTGTCTCGCGC
rJMSF038K11+ ACCTCACCATCGAAGAAAGGCGTGCGCTTGAGGGCGAAATCGTTCGCAAGTGTCTCGCGC
JMSF038K11- ACCTCACCATCGAAGAAAGGCGTGCGCTTGAGGGCGAAATCGTTCGCAAGTGTCTCGCGC
                      ____________________________________________________________
consensus ACCTCACCATCGAAGAAAGGCGTGCGCTTGAGGGCGAAATCGTTCGCAAGTGTCTCGCGC
 
. : . : . : . : . : . :
JMSF027C02- GGAATGAGCAACAGTGTTCATTCGTGGAGCATCGTAACTACAAAATAGTCTACAGGCGAT
rJMSF027C02+ GGAATGAGCAACAGTGTTCATTCGTGGAGCATCGTAACTACAAAATAGTCTACAGGCGAT
rJMSF038K11+ GGAATGAGCAACAGTGTTCATTCGTGGAGCATCGTAACTACAAAATAGTCTACAGGCGAT
JMSF038K11- GGAATGAGCAACAGTGTTCATTCGTGGAGCATCGTAACTACAAAATAGTCTACAGGCGAT
                      ____________________________________________________________
consensus GGAATGAGCAACAGTGTTCATTCGTGGAGCATCGTAACTACAAAATAGTCTACAGGCGAT
 
. : . : . : . : . : . :
JMSF027C02- ATGCGTCACTATTTTTCATGGTTGGAGTTGACAATGAAGAAAATGAGCTTGCAATTTTGG
rJMSF027C02+ ATGCGTCACTATTTTTCATGGTTGGAGTTGACAATGAAGAAAATGAGCTTGCAATTTTGG
rJMSF038K11+ ATGCGTCACTATTTTTCATGGTTGGAGTTGACAATGAAGAAAATGAGCTTGCAATTTTGG
JMSF038K11- ATGCGTCACTATTTTTCATGGTTGGAGTTGACAATGAAGAAAATGAGCTTGCAATTTTGG
                      ____________________________________________________________
consensus ATGCGTCACTATTTTTCATGGTTGGAGTTGACAATGAAGAAAATGAGCTTGCAATTTTGG
 
. : . : . : . : . : . :
JMSF027C02- AATTCATTCACCTGCTAGTTGAAACAATGGATCGTCATTTTGGCAACGTGTGCGAGTTGG
rJMSF027C02+ AATTCATTCACCTGCTAGTTGAAACAATGGATCGTCATTTTGGCAACGTGTGCGAGTTGG
rJMSF038K11+ AATTCATTCACCTGCTAGTTGAAACAATGGATCGTCATTTTGGCAACGTGTGCGAGTTGG
JMSF038K11- AATTCATTCACCTGCTAGTTGAAACAATGGATCGTCATTTTGGCAACGTGTGCGAGTTGG
                      ____________________________________________________________
consensus AATTCATTCACCTGCTAGTTGAAACAATGGATCGTCATTTTGGCAACGTGTGCGAGTTGG
 
. : . : . : . : . : . :
JMSF027C02- ATATCATGTTTCATCTGGAGAAAGCGCACTTCATGCTGGAGGAGATGGTGATGAACGGGT
rJMSF027C02+ ATATCATGTTTCATCTGGAGAAAGCGCACTTCATGCTGGAGGAGATGGTGATGAACGGGT
rJMSF038K11+ ATATCATGTTTCATCTGGAGAAAGCGCACTTCATGCTGGAGGAGATGGTGATGAACGGGT
JMSF038K11- ATATCATGTTTCATCTGGAGAAAGCGCACTTCATGCTGGAGGAGATGGTGATGAACGGGT
                      ____________________________________________________________
consensus ATATCATGTTTCATCTGGAGAAAGCGCACTTCATGCTGGAGGAGATGGTGATGAACGGGT
 
. : . : . : . : . : . :
JMSF027C02- GTATTGTTGAGACGAGCAAGTCCAACATTTTGTCTCCCATACAGCTAGTGGACAAAGCAT
rJMSF027C02+ GTATTGTTGAGACGAGCAAGTCCAACATTTTGTCTCCCATACAGCTAGTGGACAAAGCAT
rJMSF038K11+ GTATTGTTGAGACGAGCAAGTCCAACATTTTGTCTCCCATACAGCTAGTGGACAAAGCAT
JMSF038K11- GTATTGTTGAGACGAGCAAGTCCAACATTTTGTCTCCCATACAGCTAGTGGACAAAGCAT
                      ____________________________________________________________
consensus GTATTGTTGAGACGAGCAAGTCCAACATTTTGTCTCCCATACAGCTAGTGGACAAAGCAT
 
. : . : . : . : . : . :
JMSF027C02- CATAAGCTTGATCATTGTTTGTGTGTCTACTTTGCATTGGCTTANTAACTCTCAGCT
rJMSF027C02+ CATAAGCTTGATCATTGTTTGTGTGTCTACTTTGCATTGGCTTAGTAACTCTCAGCTTCT
rJMSF038K11+ CATAAGCTTGATCATTGTTTGTGTGTCTACTTTGCATTGGCTTAGTAACTCTCAGCTTCT
JMSF038K11- CATAAGCTTGATCATTGTTTGTGTGTCTACTTTGCATTGGCTTAGTAACTCTCAGCTTCT
                      ____________________________________________________________
consensus CATAAGCTTGATCATTGTTTGTGTGTCTACTTTGCATTGGCTTAGTAACTCTCAGCTTCT
 
. : . : . : . : . : . :
rJMSF027C02+ ATTGAGTTTGTTATATTACATTACATTTTGAAGGCAAAATAGGTGTTGATATTGCAGGAC
rJMSF038K11+ ATTGAGTTTGTTATATTACATTACATTTTGAAGGCAAAATAGGTGTTGATATTGCAGGAC
JMSF038K11- ATTGAGTTTGTTATATTACATTACATTTTGAAGGCAAAATAGGTGTTGATATTGCAGGAC
                      ____________________________________________________________
consensus ATTGAGTTTGTTATATTACATTACATTTTGAAGGCAAAATAGGTGTTGATATTGCAGGAC
 
. : . : . : . : . : . :
rJMSF027C02+ ATAAATTGGTCATTCTCCATTGCCAGTTACGAGTTA
rJMSF038K11+ ATAAATTGGTCATTCTCCATTGCCAGTTACGAGTTAATTTCACTTT
JMSF038K11- ATAAATTGGTCATTCTCCATTGCCAGTTACGAGTTAATTTCACTTTTGGAGTTTTGTATT
                      ____________________________________________________________
consensus ATAAATTGGTCATTCTCCATTGCCAGTTACGAGTTAATTTCACTTTTGGAGTTTTGTATT