Previous Contig 007231:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS099D12Sequence626007231 (3)gb:AB119477_15279293e-78Nicotiana tabacum mRNA for 14-3-3 g-1 protein, complete cds.>gb:AF299256_1784211
JMSF038K09Sequence669007231 (3)gb:AB119477_15279291e-88Nicotiana tabacum mRNA for 14-3-3 g-1 protein, complete cds.>gb:AF299256_1784211879007231 (3)sp|P93207|143A_LYCESe-11714-3-3 protein 10.>gb:LETFT10_1684663 Lycopersicone esculentum mRNA for 14-3-3 p

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF038K09- AAAAGGAAATATGGCGACTAGTGGCT
                      ____________________________________________________________
consensus AAAAGGAAATATGGCGACTAGTGGCT
 
. : . : . : . : . : . :
rJMSF038K09- CCCAGCAGTTACATAATAAGAGTTGAATGTGAAACACATCATATGCTATATGATTACAAC
                      ____________________________________________________________
consensus CCCAGCAGTTACATAATAAGAGTTGAATGTGAAACACATCATATGCTATATGATTACAAC
 
. : . : . : . : . : . :
rJMSF038K09- CCTAGTTCATACACAACACCAAATTAGCGAGCACATGACATTCAAAGCCCACCTCCGAAA
                      ____________________________________________________________
consensus CCTAGTTCATACACAACACCAAATTAGCGAGCACATGACATTCAAAGCCCACCTCCGAAA
 
. : . : . : . : . : . :
rJMSF038K09- AGGAGAGTATAATGATTTGTTGGCCTGATAAGATCAAGGCTCATCCAACTGATCCTGGGC
                      ____________________________________________________________
consensus AGGAGAGTATAATGATTTGTTGGCCTGATAAGATCAAGGCTCATCCAACTGATCCTGGGC
 
. : . : . : . : . : . :
rJMSF038K09- ATCAGAAGTCCAGAGGGTCAGATTGTCTCGTAGGAGTTGCATTATGAGGGTGCTATCCTT
                      ____________________________________________________________
consensus ATCAGAAGTCCAGAGGGTCAGATTGTCTCGTAGGAGTTGCATTATGAGGGTGCTATCCTT
 
. : . : . : . : . : . :
rJMSF038K09- GTATGATTCCTCACCCAAGGTATCCAGCTCAGCTATGGCTTCCTCAAATGCCTGTTTTGC
                      ____________________________________________________________
consensus GTATGATTCCTCACCCAAGGTATCCAGCTCAGCTATGGCTTCCTCAAATGCCTGTTTTGC
 
. : . : . : . : . : . :
rJMSF038K09- CATGCTACATGCTTTGTCAGATGAGTTGAGAATTTCATAATAGAAACCTGAGAAATTCAA
                      ____________________________________________________________
consensus CATGCTACATGCTTTGTCAGATGAGTTGAGAATTTCATAATAGAAACCTGAGAAATTCAA
 
. : . : . : . : . : . :
rJMSF038K09- CGCCAGACCCAGTCTTATGGGATGTGTTGGGGACAGATCTTCCTGAGCAATTTCCTGAGC
JMFS099D12+ CCTGAGC
JMSF038K09+ CCTGAGC
                      ____________________________________________________________
consensus CGCCAGACCCAGTCTTATGGGATGTGTTGGGGACAGATCTTCCTGAGCAATTTCCTGAGC
 
. : . : . : . : . : . :
rJMSF038K09- AGCCTTGTAGGAGTTCATAGTATCATCAGCAGCCTCCTTTCGTTCATCTCCAACCTTGAA
JMFS099D12+ AGCCTTGTAGGAGTTCATAGTATCATCAGCAGCCTCCTTTCGTTCATCTCCAACCTTGAA
JMSF038K09+ AGCCTTGTAGGAGTTCATAGTATCATCAGCAGCCTCCTTTCGTTCATCTCCAACCTTGAA
                      ____________________________________________________________
consensus AGCCTTGTAGGAGTTCATAGTATCATCAGCAGCCTCCTTTCGTTCATCTCCAACCTTGAA
 
. : . : . : . : . : . :
rJMSF038K09- CTCGGCGAGGTAGCGGTAGTAATCGCCCTTCATCTTGAGGTAAAACACCTTGGACTCGCT
JMFS099D12+ CTCGGCGAGGTAGCGGTAGTAATCGCCCTTCATCTTGAGGTAAAACACCTTGGACTCGCT
JMSF038K09+ CTCGGCGAGGTAGCGGTAGTAATCGCCCTTCATCTTGAGGTAAAACACCTTGGACTCGCT
                      ____________________________________________________________
consensus CTCGGCGAGGTAGCGGTAGTAATCGCCCTTCATCTTGAGGTAAAACACCTTGGACTCGCT
 
. : . : . : . : . : . :
rJMSF038K09- GGAGGTAGCCGAGGGAACCAGATTTGATTCAAGCAGCTTGAGGATGCCGGCGCAGACCTG
JMFS099D12+ GGAGGTAGCCGAGGGAACCAGATTTGATTCAAGCAGCTTGAGGATGCCGGCGCAGACCTG
JMSF038K09+ GGAGGTAGCCGAGGGAACCAGATTTGATTCAAGCAGCTTGAGGATGCCGGCGCAGACCTG
                      ____________________________________________________________
consensus GGAGGTAGCCGAGGGAACCAGATTTGATTCAAGCAGCTTGAGGATGCCGGCGCAGACCTG
 
. : . : . : . : . : . :
rJMSF038K09- AGAGAGTTCGGTCTCGACCTTTCCTCGGTAGTCCTTGACGAGGGAGACGTGCTCTTCGTT
JMFS099D12+ AGAGAGTTCGGTCTCGACCTTTCCTCGGTAGTCCTTGACGAGGGAGACGTGCTCTTCGTT
JMSF038K09+ AGAGAGTTCGGTCTCGACCTTTCCTCGGTAGTCCTTGACGAGGGAGACGTGCTCTTCGTT
                      ____________________________________________________________
consensus AGAGAGTTCGGTCTCGACCTTTCCTCGGTAGTCCTTGACGAGGGAGACGTGCTCTTCGTT
 
. : . : . : . : . : . :
rJMSF038K09- CTTCCGGGACTCCTCCTTCTGCTCGATAGATGAGACAATGCGCCAGGCGGCTCGGAGCGA
JMFS099D12+ CTTCCGGGACTCCTCCTTCTGCTCGATAGATGAGACAATGCGCCAGGCGGCTCGGAGCGA
JMSF038K09+ CTTCCGGGACTCCTCCTTCTGCTCGATAGATGAGACAATGCGCCAGGCGGCTCGGAGCGA
                      ____________________________________________________________
consensus CTTCCGGGACTCCTCCTTCTGCTCGATAGATGAGACAATGCGCCAGGCGGCTCGGAGCGA
 
. : . : . : . : . : . :
rJMSF038K09- GCCGATAACGTTCTTGTAGGCCACGGAGAGGAGGTTGCGCTCCTCGACTGTTAGCTCCGC
JMFS099D12+ GCCGATAACGTTCTTGTAGGCCACGGAGAGGAGGTTGCGCTCCTCGACTGTTAGCTCCGC
JMSF038K09+ GCCGATAACGTTCTTGTAGGCCACGGAGAGGAGGTTGCGCTCCTCGACTGTTAGCTCCGC
                      ____________________________________________________________
consensus GCCGATAACGTTCTTGTAGGCCACGGAGAGGAGGTTGCGCTCCTCGACTGTTAGCTCCGC
 
. : . : . : . : . : . :
rJMSF038K09- GGCGGGGGTGGAACCGAGAACCAGCTTGTCCATGAACTGCACCATCTCCTCATAGCGTTC
JMFS099D12+ GGCGGGGGTGGAACCGAGAACCAGCTTGTCCATGAACTGCACCATCTCCTCATAGCGTTC
JMSF038K09+ GGCGGGGGTGGAACCGAGAACCAGCTTGTCCATGAACTGCACCATCTCCTCATAGCGTTC
                      ____________________________________________________________
consensus GGCGGGGGTGGAACCGAGAACCAGCTTGTCCATGAACTGCACCATCTCCTCATAGCGTTC
 
. : . : . : . : . : . :
rJMSF038K09- CGCTTGCTCGGCG
JMFS099D12+ CGCTTGCTCGGCGAGCTTAGCCAAATAGACGTACTGCTCGCGCGACAGGTTATCGACGGC
JMSF038K09+ CGCTTGCTCGGCGAGCTTAGCCAAATAGACGTACTGCTCGCGCGACAGGTTATCGACGGC
                      ____________________________________________________________
consensus CGCTTGCTCGGCGAGCTTAGCCAAATAGACGTACTGCTCGCGCGACAGGTTATCGACGGC
 
. : . : . : . : . : . :
JMFS099D12+ GGCCGCCATTTTCGTAGAGAGAGAATT-AAAAACAGGGGAGAAAT
JMSF038K09+ GGCCGCCATTTTCGTAGAGAGAGAATTGAAAAACAGGGGAGAAATAGAGAAGAGAAGAAT
                      ____________________________________________________________
consensus GGCCGCCATTTTCGTAGAGAGAGAATTGAAAAACAGGGGAGAAATAGAGAAGAGAAGAAT
 
. : . : . : . : . : . :
JMSF038K09+ AATGACTTGGCTTTTTCTCTGATTTTCTGCGGACAGTTTTAGAGCGACATTCAGATTCCC
                      ____________________________________________________________
consensus AATGACTTGGCTTTTTCTCTGATTTTCTGCGGACAGTTTTAGAGCGACATTCAGATTCCC