Previous Contig 007222:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF013E10Sequence251007222 (3)gb:AY088040_15730641e-18Arabidopsis thaliana clone 40594 mRNA, complete sequence.700011385 (2)gb:AY075617_15677626e-53Arabidopsis thaliana AT3g25560/MWL2_18 mRNA, complete cds.>gb:BT002619_1636222 A
JMSF038H20Sequence614007222 (3)gb:AY088040_15730642e-30Arabidopsis thaliana clone 40594 mRNA, complete sequence.758023807pir|T51383|T513838e-63receptor protein kinase-like protein - Arabidopsis thaliana>gb:CQ768557_1451796
JMSF052E11Sequence679007222 (3)gb:AY088040_15730641e-67Arabidopsis thaliana clone 40594 mRNA, complete sequence.971024509gb:AY088040_1573064e-119Arabidopsis thaliana clone 40594 mRNA, complete sequence.

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF052E11+ GGAAA
                      ____________________________________________________________
consensus GGAAA
 
. : . : . : . : . : . :
JMSF052E11+ CCTTGGCACAGGTCCACTCAAGTTATTGTATGATAAATCCACGAGAGAAAGCTGAGTCAT
                      ____________________________________________________________
consensus CCTTGGCACAGGTCCACTCAAGTTATTGTATGATAAATCCACGAGAGAAAGCTGAGTCAT
 
. : . : . : . : . : . :
JMSF052E11+ GTTTGTCAGCGACGCTGGGATTTCCCCCCACAGGCTGTTATTGTTGAGCCTCAAGTACTT
                      ____________________________________________________________
consensus GTTTGTCAGCGACGCTGGGATTTCCCCCCACAGGCTGTTATTGTTGAGCCTCAAGTACTT
 
. : . : . : . : . : . :
JMSF052E11+ GAGGCCTTTCAAATGTCCCAAAGGAGGGATTTCACCAGTGAAGATGTTATTAGAAAGATC
                      ____________________________________________________________
consensus GAGGCCTTTCAAATGTCCCAAAGGAGGGATTTCACCAGTGAAGATGTTATTAGAAAGATC
 
. : . : . : . : . : . :
JMSF052E11+ GAGTGTGTGAAGATTCGAGAGGCGATTAATCTCTACCGGGATTGGTCCTGTTATGTTGTT
                      ____________________________________________________________
consensus GAGTGTGTGAAGATTCGAGAGGCGATTAATCTCTACCGGGATTGGTCCTGTTATGTTGTT
 
. : . : . : . : . : . :
JMSF052E11+ GCTCTGCAAGAGTATGATCTGGAGGTTTGTCAAATTCCCAATGCTTGGAGAAAGAGTTCC
                      ____________________________________________________________
consensus GCTCTGCAAGAGTATGATCTGGAGGTTTGTCAAATTCCCAATGCTTGGAGAAAGAGTTCC
 
. : . : . : . : . : . :
JMSF013E10+ GTGAC
JMSF052E11+ AGACAAATACTGGCTGGGAGTTCCCAGTCCAATAACCAGACTCTCTGCAGAACAAGTGAC
JMSF038H20+ CAGTCCAATAACCAGACTNTCTGCAGAACAAGTGAC
                      ____________________________________________________________
consensus AGACAAATACTGGCTGGGAGTTCCCAGTCCAATAACCAGACTCTCTGCAGAACAAGTGAC
 
. : . : . : . : . : . :
JMSF013E10+ CATGGACCAGCTACATGGATCAACAGCATCCCCATCCCAGTTATCAAGAACCCCATGAGG
JMSF052E11+ CATAGTCCAGCTACATGGATCAACAGCATCCCCATCCCAATTATCAAGAACACCATGGGG
JMSF038H20+ CATAGTCCAGCTACATGGATCAACAGCATCCCCATCCCAATTATCAAGAACACCATGGGG
                      ____________________________________________________________
consensus CATAGTCCAGCTACATGGATCAACAGCATCCCCATCCCAATTATCAAGAACACCATGGGG
 
. : . : . : . : . : . :
JMSF013E10+ ATCTTTCAGAGAAGCCTTTATGCCCATTAAAGCTTGCACTTCAAAGTTTACACCTTTAGG
JMSF052E11+ ATCCTTTAGAGCAGCTTTTATCCCCATTAAAGCTTGCACTTCAAAGTTCACACCTTTGGG
JMSF038H20+ ATCCTTTAGAGCAGCTTTTATCCCCATTAAAGCTTGCACTTCAAAGTTCACACCTTTGGG
                      ____________________________________________________________
consensus ATCCTTTAGAGCAGCTTTTATCCCCATTAAAGCTTGCACTTCAAAGTTCACACCTTTGGG
 
. : . : . : . : . : . :
JMSF013E10+ GGATAGCA
JMSF052E11+ GGACAGCACACTAACTGCAGAGCCCAAAAAACACAGAAATAGAAATCCCAGAGACCAATA
JMSF038H20+ GGACAGCACACTAACTGCAGAGCCCAAAAAACACAGAAATAGAAATCCCAGAGACCAATA
                      ____________________________________________________________
consensus GGACAGCACACTAACTGCAGAGCCCAAAAAACACAGAAATAGAAATCCCAGAGACCAATA
 
. : . : . : . : . : . :
JMSF052E11+ CACACCCTTTGCTTCTCTCCTCATCTCCACTCAAATGATTATCCAGAAAACAGAAGCTAC
JMSF038H20+ CACACCCTTTGCTTCTCTCCTCATCTCCACTCAAATGATTATCCAGAAAACAGAAGCTAC
                      ____________________________________________________________
consensus CACACCCTTTGCTTCTCTCCTCATCTCCACTCAAATGATTATCCAGAAAACAGAAGCTAC
 
. : . : . : . : . : . :
JMSF052E11+ AGTGTTATGAACTCAGTGAGTCATCCCTCCTTCAAATGAGGGTTTTGAGGAATCTGGGAG
JMSF038H20+ AGTGTTATGAACTCAGTGAGTCATCCCTCCTTCAAATGAGGGTTTTGAGGAATCTGGGAG
                      ____________________________________________________________
consensus AGTGTTATGAACTCAGTGAGTCATCCCTCCTTCAAATGAGGGTTTTGAGGAATCTGGGAG
 
. : . : . : . : . : . :
JMSF052E11+ TCTCAACAATCT
JMSF038H20+ TCTCAACAATCTTAGCATTCTAAGCATGTCAGTAACTCAATTATACTGCTATCTTTATCC
                      ____________________________________________________________
consensus TCTCAACAATCTTAGCATTCTAAGCATGTCAGTAACTCAATTATACTGCTATCTTTATCC