Previous Contig 007213:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF006C18Sequence491007213 (4)779008418 (4)pir|T01892|T018928e-76hypothetical protein F8M12.21 - Arabidopsis thaliana>gb:ATCHRIV30_1544849 Arabid
JMFF029K18Sequence247007213 (4)743008418 (4)gb:AY086489_15715372e-74Arabidopsis thaliana clone 2538 mRNA, complete sequence.
JMSF013M23Sequence254007213 (4)752008418 (4)gb:AY086489_15715374e-81Arabidopsis thaliana clone 2538 mRNA, complete sequence.
JMSF038G01Sequence611007213 (4)gb:AY086489_15715371e-12Arabidopsis thaliana clone 2538 mRNA, complete sequence.874008418 (4)gb:AY086489_15715372e-90Arabidopsis thaliana clone 2538 mRNA, complete sequence.

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF038G01+ ACCCTCACCGG
                      ____________________________________________________________
consensus ACCCTCACCGG
 
. : . : . : . : . : . :
JMSF038G01+ ACGCAATCGTGTCCCGAGCGAGCTTCAACAGGAATGGCCCGAGATCCGGGTTGTCAAGCG
                      ____________________________________________________________
consensus ACGCAATCGTGTCCCGAGCGAGCTTCAACAGGAATGGCCCGAGATCCGGGTTGTCAAGCG
 
. : . : . : . : . : . :
JMFF006C18+ TTTCCGGAGCCCCGATCCG
JMSF038G01+ ACGATTCGTCGATAACAGCCTTCTCCGGCGGCGATTTCTTCTTTCCGGAGCCCCGATCCG
                      ____________________________________________________________
consensus ACGATTCGTCGATAACAGCCTTCTCCGGCGGCGATTTCTTCTTTCCGGAGCCCCGATCCG
 
. : . : . : . : . : . :
JMFF006C18+ GCGACGGCTTGGCTCGTGAGGTGGACGGGGAAGGAGAGGGAGGACGCCGTGGAGCTGGCG
JMSF038G01+ GCGACGGCTTGGCTCGTGAGGTGGACGGGGAAGGAGAGGGAGGACGCCGTGGAGCTGGCG
                      ____________________________________________________________
consensus GCGACGGCTTGGCTCGTGAGGTGGACGGGGAAGGAGAGGGAGGACGCCGTGGAGCTGGCG
 
. : . : . : . : . : . :
JMFF006C18+ AGCTGGGCTTCGTGTTAACATTCTCGGATCTACTCGAATTAGCTCCGATCTGGCCNTGAC
JMSF038G01+ AGCTGGGCTTCGTGTTAACATTCTCGGATCTACTCGAATTAGCTCCGATCTGGCCTTGAC
                      ____________________________________________________________
consensus AGCTGGGCTTCGTGTTAACATTCTCGGATCTACTCGAATTAGCTCCGATCTGGCCTTGAC
 
. : . : . : . : . : . :
JMFF006C18+ TCTCGTCTGGAACTGTGATTCTCAATGGCGTAGCTTCCGGCGGCGTTTTAACTGAAACTA
JMSF038G01+ TCTCGTCTGGAACTGTGATTCTCAATGGCGTAGCTTCCGGCGGCGTTTTAACTGAAACTA
                      ____________________________________________________________
consensus TCTCGTCTGGAACTGTGATTCTCAATGGCGTAGCTTCCGGCGGCGTTTTAACTGAAACTA
 
. : . : . : . : . : . :
JMSF013M23+ CAAANCAAAAAAATCC
JMFF029K18+ CAAAACAAAAAAATCC
JMFF006C18+ TTCCCGGCATTTCCTCAATTCACAACAGAAAAACAAAAACAAAACAAAACAAAAAAATCC
JMSF038G01+ TTCCCGGCATTTCCTCAATTCACAACAGAAAAACAAAAACAAAACAAAACAAAAAAATCC
                      ____________________________________________________________
consensus TTCCCGGCATTTCCTCAATTCACAACAGAAAAACAAAAACAAAACAAAACAAAAAAATCC
 
. : . : . : . : . : . :
JMSF013M23+ CTCTTTCCCCTAAGAAAACCGATCGAATTTATCAAACCGATATCCTGTATTATACAATCG
JMFF029K18+ CTCTTTCCCCTAAGAAAACCGATCGAATTTATCAAACCGATATCCTGTATTATACAATCG
JMFF006C18+ CTCTTTCCCCTAAGAAAACCGATCGAATTTATCAAACCGATATCCTGTATTATACAATCG
JMSF038G01+ CTCTTTCCCCTAAGAAAACCGATCGAATTTATCAAACCGATATCCTGTATTATACAATCG
                      ____________________________________________________________
consensus CTCTTTCCCCTAAGAAAACCGATCGAATTTATCAAACCGATATCCTGTATTATACAATCG
 
. : . : . : . : . : . :
JMSF013M23+ CCAAAAAGCGTTACCAATAAGTAATTAATGAGAGATTAAGAGACTGAATTATAGACTACA
JMFF029K18+ CCAAAAAGCGTTACCAATAAGTAATTAATGAGAGATTAAGAGANTGAATTATAGACTACA
JMFF006C18+ CCAAAAAGCGTTACCAATAAGTAATTAATGAGAGATTAAGAGACTGAATTATAGACTACA
JMSF038G01+ CCAAAAAGCGTTACCAATAAGTAATTAATGAGAGATTAAGAGACTGAATTATAGACTACA
                      ____________________________________________________________
consensus CCAAAAAGCGTTACCAATAAGTAATTAATGAGAGATTAAGAGACTGAATTATAGACTACA
 
. : . : . : . : . : . :
JMSF013M23+ ACAGGCCACCATTCTCTACTGTTGAAGAACAGTTTAGAGCTTAGGAGATAGAGAGAGAGA
JMFF029K18+ ACAGGCCACCATTCTCTACTGNTGAAGAACAGTTTAGAGCTTAGGAGATAGAGAGAGAGA
JMFF006C18+ ACAGGCCACCATTCTCTACTGTTGAAGAACAGTTTAGAGCTTAGGAGATAGAGAGAGAGA
JMSF038G01+ ACAGGCCACCATTCTCTACTGTTGAAGAACAGTTTAGAGCTTAGGAGATAGAGAGAGAGA
                      ____________________________________________________________
consensus ACAGGCCACCATTCTCTACTGTTGAAGAACAGTTTAGAGCTTAGGAGATAGAGAGAGAGA
 
. : . : . : . : . : . :
JMSF013M23+ GAGAGAGAGGGAGGAAGATGAAGTTCAGCTGAAGACGAGACTGGGGACC
JMFF029K18+ GAGAGAGAGGGAGGAAGATGAAGTTCAGCTGAAGACGAGACTGGGGACC
JMFF006C18+ GAGAGAGAGGGAGGAAGATGAAGTTCAGCTGAAGACGAGACTGGGGACC
JMSF038G01+ GAGAGAGAGGGAGGAAGATGAAGTTCAGCTGAAGACGAGACTGGGGACCAGCGGTCAGTC
                      ____________________________________________________________
consensus GAGAGAGAGGGAGGAAGATGAAGTTCAGCTGAAGACGAGACTGGGGACCAGCGGTCAGTC