Previous Contig 007208:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF009A01Sequence283007208 (2)714013149 (2)gb:AY166798_15862303e-52Citrus unshiu sugar transporter (Sut) mRNA, complete cds.
JMSF038E10Sequence678007208 (2)pir|F96696|F966961e-42protein F1N21.12 [imported] - Arabidopsis thaliana>gb:AE005173_894352 Arabidopsi909013149 (2)gb:AY166798_15862303e-82Citrus unshiu sugar transporter (Sut) mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF038E10+ CATGGGCAAAGAACACAA
                      ____________________________________________________________
consensus CATGGGCAAAGAACACAA
 
. : . : . : . : . : . :
JMSF038E10+ CTGAAAAGCCNTACGGCGCCCAATCCCATCAGCAACCCAACCACTGAACAAAGATCCAAC
                      ____________________________________________________________
consensus CTGAAAAGCCNTACGGCGCCCAATCCCATCAGCAACCCAACCACTGAACAAAGATCCAAC
 
. : . : . : . : . : . :
JMSF038E10+ AAAAGCACCAGCAAGACACGTACTGACCACCAGACCTTCTGCGAGTGTATCCCCTTTGAA
                      ____________________________________________________________
consensus AAAAGCACCAGCAAGACACGTACTGACCACCAGACCTTCTGCGAGTGTATCCCCTTTGAA
 
. : . : . : . : . : . :
JMSF038E10+ TCCAAGATCAATGGAAATGCTTTCGAGTGGCTCATTAACTACTCCAAGATGATAACCAAA
                      ____________________________________________________________
consensus TCCAAGATCAATGGAAATGCTTTCGAGTGGCTCATTAACTACTCCAAGATGATAACCAAA
 
. : . : . : . : . : . :
JMSF038E10+ CAAGAATGAAACCATTGTTGCCACAAGTACATGTGGACACGAATATTTCCAGGAGGGATT
                      ____________________________________________________________
consensus CAAGAATGAAACCATTGTTGCCACAAGTACATGTGGACACGAATATTTCCAGGAGGGATT
 
. : . : . : . : . : . :
JMSF038E10+ TGACATCTCTTGCTGAGCACCATTCTGGAGGAAACCTAAATCATCATCCTGATCAGCTTC
                      ____________________________________________________________
consensus TGACATCTCTTGCTGAGCACCATTCTGGAGGAAACCTAAATCATCATCCTGATCAGCTTC
 
. : . : . : . : . : . :
JMSF038E10+ AAAATCATCGACATTCATGTAATCTCTCGACGGCATTCTCTTATACATCGAGGAGGAAAC
                      ____________________________________________________________
consensus AAAATCATCGACATTCATGTAATCTCTCGACGGCATTCTCTTATACATCGAGGAGGAAAC
 
. : . : . : . : . : . :
JMSF038E10+ ACGTGATTGCACAAGCATGCCACAACTTCCCTTCCTTTACCTCCAAACCTGCAATCCCAA
                      ____________________________________________________________
consensus ACGTGATTGCACAAGCATGCCACAACTTCCCTTCCTTTACCTCCAAACCTGCAATCCCAA
 
. : . : . : . : . : . :
JMSF009A01+ CTCCGATCATTCAACGACCGGAGCAGCACGGATTTCCAATCCGAAAG
JMSF038E10+ GAACTCAACGGAACTCCGATCATTCAACGACCGGAGCAGCACGGATTTCCAATCCGAAAG
                      ____________________________________________________________
consensus GAACTCAACGGAACTCCGATCATTCAACGACCGGAGCAGCACGGATTTCCAATCCGAAAG
 
. : . : . : . : . : . :
JMSF009A01+ CGAGAAAACGGCGACGCTTTGTCGAAGCCTGAGAAGTCCTTACACACGACTCTACAGATT
JMSF038E10+ CGAGAAAACGGCGACGCTTTGTCGAAGCCTGAGAAGTCCTTACACACGACTCTACAGATT
                      ____________________________________________________________
consensus CGAGAAAACGGCGACGCTTTGTCGAAGCCTGAGAAGTCCTTACACACGACTCTACAGATT
 
. : . : . : . : . : . :
JMSF009A01+ ATTTCTTCTGGAAGCTCCGGAAACTGCTAACAC
JMSF038E10+ ATTTCTTCTGGAAGCTCCGGAAACTGCTAACACATCCTCATCTCTGTGTGTGTGTGAGCA
                      ____________________________________________________________
consensus ATTTCTTCTGGAAGCTCCGGAAACTGCTAACACATCCTCATCTCTGTGTGTGTGTGAGCA
 
. : . : . : . : . : . :
JMSF038E10+ GATGAAGGAAGAGATGTGGATGGTGAGTGCTAAAATGCGCCTGGTAGAGTTCTTGCGTCC
                      ____________________________________________________________
consensus GATGAAGGAAGAGATGTGGATGGTGAGTGCTAAAATGCGCCTGGTAGAGTTCTTGCGTCC