Previous Contig 007199:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFN025E14Sequence648007199 (5)gb:AE005172_8897333e-36Arabidopsis thaliana chromosome 1, top arm complete sequence.>gb:AC022464_153902
JMSF015J01Sequence458007199 (5)gb:AE005172_8897331e-36Arabidopsis thaliana chromosome 1, top arm complete sequence.>gb:AC022464_153902698007199 (5)
JMSF038C07Sequence637007199 (5)gb:AE005172_8897333e-36Arabidopsis thaliana chromosome 1, top arm complete sequence.>gb:AC022464_153902884007199 (5)gb:AE005172_8897337e-25Arabidopsis thaliana chromosome 1, top arm complete sequence.>gb:AC022464_153902

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF015J01- GGAGCAGCTAGATTCCATTGCAATGGATTATTCATAGTTACATT
rJMSF038C07- ATT
                      ____________________________________________________________
consensus GGAGCAGCTAGATTCCATTGCAATGGATTATTCATAGTTACATT
 
. : . : . : . : . : . :
rJMSF015J01- TTTCTTGAGGGATACTAATATACAATCATGCAGATTTCTGGGCACACAACATTGATGATA
rJMSF038C07- TTTCTTGAGGGATACTAATATACAATCATGCAGATTTCTGGGCACACAACATTGATGATA
                      ____________________________________________________________
consensus TTTCTTGAGGGATACTAATATACAATCATGCAGATTTCTGGGCACACAACATTGATGATA
 
. : . : . : . : . : . :
rJMSF015J01- ATCGAGTAAGGAATTAATTACTTTGAATGCTGGTATTTACCGTAATCATCCCTTGCAGCA
rJMSF038C07- ATCGAGTAAGGAATTAATTACTTTGAATGCTGGTATTTACCGTAATCATCCCTTGCAGCA
                      ____________________________________________________________
consensus ATCGAGTAAGGAATTAATTACTTTGAATGCTGGTATTTACCGTAATCATCCCTTGCAGCA
 
. : . : . : . : . : . :
rJMSF015J01- ATTTCACTCTCTGTGCTCTCTGCAATCTTTTCCTCTTCATATTTTATACCTCCGTCCAAT
rJMSF038C07- ATTTCACTCTCTGTGCTCTCTGCAATCTTTTCCTCTTCATATTTTATACCTCCGTCCAAT
                      ____________________________________________________________
consensus ATTTCACTCTCTGTGCTCTCTGCAATCTTTTCCTCTTCATATTTTATACCTCCGTCCAAT
 
. : . : . : . : . : . :
rJMSF015J01- GCTAGTCCTCCTAGGGCTCCGGCCACAGCTCCGGCAGCCAATCCAGCTCCCGCTCCCATC
rJMSF038C07- GCTAGTCCTCCTAGGGCTCCGGCCACAGCTCCGGCAGCCAATCCAGCTCCCGCTCCCATC
                      ____________________________________________________________
consensus GCTAGTCCTCCTAGGGCTCCGGCCACAGCTCCGGCAGCCAATCCAGCTCCCGCTCCCATC
 
. : . : . : . : . : . :
rJMSF015J01- TTCCCGCTGCGTTTGTGATCATACTGTGCATAATCCACTGGGGCGCTCGGTCCTGGCGCG
rJMSF038C07- TTCCCGCTGCGTTTGTGATCATACTGTGCATAATCCACTGGGGCGCTCGGTCCTGGCGCG
                      ____________________________________________________________
consensus TTCCCGCTGCGTTTGTGATCATACTGTGCATAATCCACTGGGGCGCTCGGTCCTGGCGCG
 
. : . : . : . : . : . :
rJMSF015J01- GTGGATTGCCAGGGCCGTGGAGGCGGCGGCGGTGGTTGGGAGTAGTAACAGGGGTAGCAG
rJMSF038C07- GTGGATTGCCAGGGCCGTGGAGGCGGCGGCGGTGGTTGGGAGTAGTAACAGGGGTAGCAG
JMFN025E14+ GCAG
                      ____________________________________________________________
consensus GTGGATTGCCAGGGCCGTGGAGGCGGCGGCGGTGGTTGGGAGTAGTAACAGGGGTAGCAG
 
. : . : . : . : . : . :
rJMSF015J01- TTGGAGTACGGATCACCGTATCCGCCGTAGGGATAAGTGTGCGGAGGGAGAGGCGGCGGC
rJMSF038C07- TTGGAGTACGGATCACCGTATCCGCCGTAGGGATAAGTGTGCGGAGGGAGAGGCGGCGGC
JMFN025E14+ TTGGAGTACGGATCACCGTATCCGCCGTAGGGATAAGTGTGCGGAGGGAGAGGCGGCGGC
JMSF038C07+ GCCGTAGGGATAAGTGTGCGGAGGGAGAGGCGGCGGC
                      ____________________________________________________________
consensus TTGGAGTACGGATCACCGTATCCGCCGTAGGGATAAGTGTGCGGAGGGAGAGGCGGCGGC
 
. : . : . : . : . : . :
rJMSF015J01- GGTGAGGTAGTTAGAGGTAGTGGAGGCGCGTGTGAGCTGTATGGAGCGGGATTGTATGCT
rJMSF038C07- GGTGAGGTAGTTAGAGGTAGTGGAGGCGCGTGTGAGCTGTATGGAGCGGGATTGTATGCT
JMFN025E14+ GGTGAGGTAGTTAGAGGTAGTGGAGGCGCGTGTGAGCTGTATGGAGCGGGATTGTATGCT
JMSF038C07+ GGTGAGGTAGTTAGAGGTAGTGGAGGCGCGTGTGAGCTGTATGGAGCGGGATTGTATGCT
                      ____________________________________________________________
consensus GGTGAGGTAGTTAGAGGTAGTGGAGGCGCGTGTGAGCTGTATGGAGCGGGATTGTATGCT
 
. : . : . : . : . : . :
rJMSF015J01- CCGTAGTCGCGTGTAGCCGGCGGCGGAGGTGCGGATGAGTAATAGTAGCTAGCCGGAGGA
rJMSF038C07- CCGTAGTCGCGTGTAGCCGGCGGCGGAGGTGCGGATGAGTAATAGTAGCTAGCCGGAGGA
JMFN025E14+ CCGTAGTCGCGTGTAGCCGGCGGCGGAGGTGCGGATGAGTAATAGTAGCTAGCCGGAGGA
JMSF038C07+ CCGTAGTCGCGTGTAGCCGGCGGCGGAGGTGCGGATGAGTAATAGTAGCTAGCCGGAGGA
                      ____________________________________________________________
consensus CCGTAGTCGCGTGTAGCCGGCGGCGGAGGTGCGGATGAGTAATAGTAGCTAGCCGGAGGA
 
. : . : . : . : . : . :
rJMSF015J01- GGAATTTGGTATTCCTGGATCTTCCGGACGGCGATTTTGAGTCGGATCTTACCCTGAGGA
rJMSF038C07- GGAATTTGGTATTCCTGGATCTTCCGGACGGCGATTTTGAGTCGGATCTTACCCTGAGGA
JMFN025E14+ GGAATTTGGTATTCCTGGATCTTCCGGACGGCGATTTTGAGTCGGATCTTACCCTGAGGA
JMSF015J01+ TTCCGGACGGCGATTTTGAGTCGGATCTTACCCTGAGGA
JMSF038C07+ GGAATTTGGTATTCCTGGATCTTCCGGACGGCGATTTTGAGTCGGATCTTACCCTGAGGA
                      ____________________________________________________________
consensus GGAATTTGGTATTCCTGGATCTTCCGGACGGCGATTTTGAGTCGGATCTTACCCTGAGGA
 
. : . : . : . : . : . :
rJMSF015J01- CGACCGGAGGGGCGGCGGAGCTGGAAAGCTTTCAGTTGAGTTGAATCGCCCGAG
rJMSF038C07- CGACCGGAGGGGCGGCGGAGCTGGAAAGCTTTCAGTTGAGTTGAATCGCCCGAGTCGACG
JMFN025E14+ CGACCGGAGGGGCGGCGGAGCTGGAAAGCTTTCAGTTGAGTTGAATCGCCCGAGTCGACG
JMSF015J01+ CGACCGGAGGGGCGGCGGAGCTGGAAAGCTTTCAGTTGAGTTGAATCGCCCGAGTCGACG
JMSF038C07+ CGACCGGAGGGGCGGCGGAGCTGGAAAGCTTTCAGTTGAGTTGAATCGCCCGAGTCGACG
                      ____________________________________________________________
consensus CGACCGGAGGGGCGGCGGAGCTGGAAAGCTTTCAGTTGAGTTGAATCGCCCGAGTCGACG
 
. : . : . : . : . : . :
rJMSF038C07- ACCAGGTCCTTGAGCGGAATCCGAAGCGTACCTACCAGCGGCTTGGGGGTTTCGGAGGGG
JMFN025E14+ ACCAGGTCCTTGAGCGGAATCCGAAGCGTACCTACCAGCGGCTTGGGGGTTTCGGAGGGG
JMSF015J01+ ACCAGGTCCTTGAGCGGAATCCGAAGCGTACCTACCAGCGGCTTGGGGGTTTCGGAGGGG
JMSF038C07+ ACCAGGTCCTTGAGCGGAATCCGAAGCGTACCTACCAGCGGCTTGGGGGTTTCGGAGGGG
                      ____________________________________________________________
consensus ACCAGGTCCTTGAGCGGAATCCGAAGCGTACCTACCAGCGGCTTGGGGGTTTCGGAGGGG
 
. : . : . : . : . : . :
rJMSF038C07- ACGGAGTGGAAGATCTCGACGGCGAGCAGCGATTCCTGCGGCGGCAGCGTGAGAGGGACG
JMFN025E14+ ACGGAGTGGAAGATCTCGACGGCGAGCAGCGATTCCTGCGGCGGCAGCGTGAGAGGGACG
JMSF015J01+ ACGGAGTGGAAGATCTCGACGGCGAGCAGCGATTCCTGCGGCGGCAGCGTGAGAGGGACG
JMSF038C07+ ACGGAGTGGAAGATCTCGACGGCGAGCAGCGATTCCTGCGGCGGCAGCGTGAGAGGGACG
                      ____________________________________________________________
consensus ACGGAGTGGAAGATCTCGACGGCGAGCAGCGATTCCTGCGGCGGCAGCGTGAGAGGGACG
 
. : . : . : . : . : . :
rJMSF038C07- ACGAAACGCTCGTTCCAGACGGGTTTGGTCGAGCCGGAATCGTCCGATTTAGTGGCGAGA
JMFN025E14+ ACGAAACGCTCGTTCCAGACGGGTTTGGTCGAGCCGGAATCGTCCGATTTAGTGGCGAGA
JMSF015J01+ ACGAAACGCTCGTTCCAGACGGGTTTGGTCGAGCCGGAATCGTCCGATTTAGTGGCGAGA
JMSF038C07+ ACGAAACGCTCGTTCCAGACGGGTTTGGTCGAGCCGGAATCGTCCGATTTAGTGGCGAGA
                      ____________________________________________________________
consensus ACGAAACGCTCGTTCCAGACGGGTTTGGTCGAGCCGGAATCGTCCGATTTAGTGGCGAGA
 
. : . : . : . : . : . :
rJMSF038C07- CGGCGGTCGGGGTCAATCCAGAGGATGACGTAAGGCTTGAG
JMFN025E14+ CGGCGGTCGGGGTCAATCCAGAGGATGACGTAAGGCTTGAGATCGCCGTGACGCCAGTTG
JMSF015J01+ CGGCGGTCGGGGTCAATCCAGAGGATGACGTAAGGCTTGAGATCGCCGTGACGCCAGTTG
JMSF038C07+ CGGCGGTCGGGGTCAATCCAGAGGATGACGTAAGGCTTGAGATCGCCGTGACGCCAGTTG
                      ____________________________________________________________
consensus CGGCGGTCGGGGTCAATCCAGAGGATGACGTAAGGCTTGAGATCGCCGTGACGCCAGTTG
 
. : . : . : . : . : . :
JMFN025E14+ ACGTTCTTCAGGTGCTTGGCGGAGACGACGGTGACGTCTACATCGTAGGATTTCGCCGGA
JMSF015J01+ ACGTTCTTCAGGTGCTTGGCGGAGACGACGGTGACGTCTACATCGTAGGATTTCGCCGGA
JMSF038C07+ ACGTTCTTCAGGTGCTTGGCGGAGACGACGGTGACGTCTACATCGTAGGATTTCGCCGGA
                      ____________________________________________________________
consensus ACGTTCTTCAGGTGCTTGGCGGAGACGACGGTGACGTCTACATCGTAGGATTTCGCCGGA
 
. : . : . : . : . : . :
JMFN025E14+ GGTCGAGCGCCTGCGGTGGCCATGACGGTCTAGTGACGCGAGCG
JMSF015J01+ GGTCGAGCGCCTGCGGTGGCCATGACGGTCTAGTGACGCGAGCGTGGAGGTGTGAAGC
JMSF038C07+ GGTCGAGCGCCTGCGGTGGCCATGACGGTCTAGTGACGCGAGCGTGGAGGTGTGAAGCGC
                      ____________________________________________________________
consensus GGTCGAGCGCCTGCGGTGGCCATGACGGTCTAGTGACGCGAGCGTGGAGGTGTGAAGCGC