Previous Contig 007190:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF011F22Sequence614007190 (5)gb:AY074312_15674703e-43Arabidopsis thaliana unknown protein (At5g14260) mRNA, complete cds.764008706 (5)gb:AY074312_15674702e-41Arabidopsis thaliana unknown protein (At5g14260) mRNA, complete cds.
JMFN002E01Sequence201007190 (5)
JMSF008F24Sequence390007190 (5)gb:AY074312_15674709e-18Arabidopsis thaliana unknown protein (At5g14260) mRNA, complete cds.783008706 (5)gb:AY065084_15662382e-54Arabidopsis thaliana putative protein (At5g14260; F18O22_50) mRNA, complete cds.
JMSF019G06Sequence581007190 (5)gb:AY074312_15674702e-52Arabidopsis thaliana unknown protein (At5g14260) mRNA, complete cds.765008706 (5)gb:AY074312_15674708e-50Arabidopsis thaliana unknown protein (At5g14260) mRNA, complete cds.
JMSF038A24Sequence647007190 (5)gb:AY074312_15674702e-43Arabidopsis thaliana unknown protein (At5g14260) mRNA, complete cds.822008706 (5)gb:AY065084_15662382e-63Arabidopsis thaliana putative protein (At5g14260; F18O22_50) mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF019G06+ TTAATGTATGGATACCAAAAGGATTT
                      ____________________________________________________________
consensus TTAATGTATGGATACCAAAAGGATTT
 
. : . : . : . : . : . :
JMSF019G06+ CTTTCCTTGCTTCTTTTCATACATGAGATAGAGTGCCAAGCAGGCTAGTTCTGATAATTT
JMFF011F22+ TTTTCATACATGAGATAGAGTGCCAAGCAGGCTAGTACTGATAATTT
JMSF038A24+ TTTTCATACATGAGATAGAGTGCCAAGCAGGCTAGTTCTGATAATTT
                      ____________________________________________________________
consensus CTTTCCTTGCTTCTTTTCATACATGAGATAGAGTGCCAAGCAGGCTAGTTCTGATAATTT
 
. : . : . : . : . : . :
JMSF019G06+ GTTGGTTGTCAAGAGTTCAGCGACAGTCTCGTTTCCCAGAACCCTCTCCAATGTTACCAC
JMFF011F22+ GTTGGTTGTCAAGAGTTCAGCGACAGTCTCGTTTCCCAGAACCCTCTCCAATGTTACCAC
JMSF038A24+ GTTGGTTGTCAAGAGTTCAGCGACAGTCTCGTTTCCCAGAACCCTCTCCAATGTTACCAC
                      ____________________________________________________________
consensus GTTGGTTGTCAAGAGTTCAGCGACAGTCTCGTTTCCCAGAACCCTCTCCAATGTTACCAC
 
. : . : . : . : . : . :
JMSF008F24+ TTCGCTGGCGGCAAC
JMSF019G06+ CAACGAGTTTGGCACAGAAAATGCAATATCACCTGTCTGAAGATCTTCGCTGGCGGCAAC
JMFF011F22+ CAACGAGTTTGGCACAGAAAATGCAATATCACCTGTCTGAAGATCTTCGCTGGCGGCAAC
JMSF038A24+ CAACGAGTTTGGCACAGAAAATGCAATATCACCTGTCTGAAGATCTTCGCTGGCGGCAAC
                      ____________________________________________________________
consensus CAACGAGTTTGGCACAGAAAATGCAATATCACCTGTCTGAAGATCTTCGCTGGCGGCAAC
 
. : . : . : . : . : . :
JMSF008F24+ GTAGTGAATGGGGCGATGTTTAGCATTGTGGGAGGGCCTCTCATCAAGCACGACCTTGCA
JMSF019G06+ GTAGTGAATGGGGCGATGTTTAGCATTGTGGGAGGGCCTCTCATCAAGCACGACCTTGCA
JMFF011F22+ GTAGTGAATGGGGCGATGTTTAGCACTGTGGGAGGGCCTCTCATCAAGCACGACCTTGCA
JMSF038A24+ GTAGTGAATGGGGCGATGTTTAGCATTGTGGGAGGGCCTCTCATCAAGCACGACCTTGCA
                      ____________________________________________________________
consensus GTAGTGAATGGGGCGATGTTTAGCATTGTGGGAGGGCCTCTCATCAAGCACGACCTTGCA
 
. : . : . : . : . : . :
JMSF008F24+ AGGAGGGAGTCCGTTGTTGTGCATCCAAGATTTCAAGTCACCCAACTCGTGGTCTTCTGA
JMSF019G06+ AGGAGGGAGTCCGTTGTTGTGCATCCAAGATTTCAAGTCACCCAACTCGTGGTCTTCTGA
JMFF011F22+ AGGAGGGAGTCCGTTGTTGTGCATCCAAGATTTCAAGTCACCCAACTCGTGGTCTTCTGA
JMSF038A24+ AGGAGGGAGTCCGTTGTTGTGCATCCAAGATTTCAAGTCACCCAACTCGTGGTCTTCTGA
                      ____________________________________________________________
consensus AGGAGGGAGTCCGTTGTTGTGCATCCAAGATTTCAAGTCACCCAACTCGTGGTCTTCTGA
 
. : . : . : . : . : . :
JMSF008F24+ CTTTACAGTGACGACCTCGTGGGATTTGTGGTGTCCATTGGGAGAGCCAGCGATGAGGGT
JMSF019G06+ CTTTACAGTGACGACCTCGTGGGATTTGTGGTGTCCATTGGGAGAGCCAGCGATGAGGGT
JMFF011F22+ CTTTACAGTGACGACCTCGTGGGATTTGTGGTGTCCATTGGGAGAGCCAGCGATGAGGGT
JMSF038A24+ CTTTACAGTGACGACCTCGTGGGATTTGTGGTGTCCATTGGGAGAGCCAGCGATGAGGGT
                      ____________________________________________________________
consensus CTTTACAGTGACGACCTCGTGGGATTTGTGGTGTCCATTGGGAGAGCCAGCGATGAGGGT
 
. : . : . : . : . : . :
JMSF008F24+ TTCGGAGTTGGAAGCAGAGCACATGTTCTTCCATCGACGCAAGTTGATGTGTTTGGGATT
JMSF019G06+ TTCGGAGTTGGAAGCAGAGCACATGTTCTTCCATCGACGCAAGTTGATGTGTTTGGGATT
JMFF011F22+ TTCGGAGTTGGAAGCAGAGCACATGTTCTTCCATCGACGCAAGTTGATGTGTTTGGGATT
JMFN002E01+ GTTCTTCCATCGACGCAAGTTGATGTGTTTGGGATT
JMSF038A24+ TTCGGAGTTGGAAGCAGAGCACATGTTCTTCCATCGACGCAAGTTGATGTGTTTGGGATT
                      ____________________________________________________________
consensus TTCGGAGTTGGAAGCAGAGCACATGTTCTTCCATCGACGCAAGTTGATGTGTTTGGGATT
 
. : . : . : . : . : . :
JMSF008F24+ GAAGAGCAAGGAATGGGAAACCCTAGAAAGAGCTAAGAGAGGGCAATGATGAGTGGGAGA
JMSF019G06+ GAAGAGCAAGGAATGGGAAACCCTAGAAAGAGCTAAGAGAGGGCAATGATGAGTGGGAGA
JMFF011F22+ GAAGAGCAAGGAATGGGAAACCCTAGAAAGAGCTAAGAGAGGGCAATGATGAGTGGGAGA
JMFN002E01+ GAAGAGCAAGGAATGGGAAACCCTAGAAAGAGCTAAGAGAGGGCAATGATGAGTGGGAGA
JMSF038A24+ GAAGAGCAAGGAATGGAAAACCCTAGAAAGAGCTAAGAGAGGGCAATGATGAGTGGGAGA
                      ____________________________________________________________
consensus GAAGAGCAAGGAATGGGAAACCCTAGAAAGAGCTAAGAGAGGGCAATGATGAGTGGGAGA
 
. : . : . : . : . : . :
JMSF008F24+ ACGAAACGGAGAAGAAATACATTTGGCTTGAAGATAAGCCACGTCCATGGCGAAAGAATT
JMSF019G06+ ACGAAACGGAGAAGAAATACATTTGGCTTGAAGATAAGCCACGTCCATGGCGAAAGAATT
JMFF011F22+ ACGAAACGGAGAAGAAATACATTTGGCTTGAAGATAAGCCACGTCCATGGCGAAAGAATT
JMFN002E01+ ACGAAACGGAGAAGAAATACATTTGGCTTGAAGATAAGCCACGTCCATGGCGAAAGAATT
JMSF038A24+ ACGAAACGGAGAAGAAATACATTTGGCTTGAAGATAAGCCACGTCCATGGCGAAAGAATT
                      ____________________________________________________________
consensus ACGAAACGGAGAAGAAATACATTTGGCTTGAAGATAAGCCACGTCCATGGCGAAAGAATT
 
. : . : . : . : . : . :
JMSF008F24+ TCAATCCTTCA
JMSF019G06+ TCAATCCTTCACT
JMFF011F22+ TCAATCCTTCACTTGCATAAAGAATAGAAATGATGATTTTTAGGGTTAAAGCTGGGTTGG
JMFN002E01+ TCAATCCTTCACTTGCATAAAGAATAGAAATGATGATTTT
JMSF038A24+ TCAATCCTTCACTTGCATAAAGAATAGAAATGATGATTTTTAGGGTTAAAGCTGGGTTGG
                      ____________________________________________________________
consensus TCAATCCTTCACTTGCATAAAGAATAGAAATGATGATTTTTAGGGTTAAAGCTGGGTTGG
 
. : . : . : . : . : . :
JMFF011F22+ GTGGGTGGATTTTCTCAGGCTGGTGAT
JMSF038A24+ GTGGGTGGATTTTCTCAGGCTGGTGATTTCTGATATGATATTTTTTCTTCAGAGCTTACC
                      ____________________________________________________________
consensus GTGGGTGGATTTTCTCAGGCTGGTGATTTCTGATATGATATTTTTTCTTCAGAGCTTACC