Previous Contig 007187:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF008H10Sequence453007187 (4)gb:AF498358_18059151e-47Medicago truncatula small G-protein ROP6 mRNA, complete cds.774007187 (4)gb:NTA250174_16912834e-74Nicotiana tabacum mRNA for putative rac protein (rac gene).>gb:NTU64923_1691869
JMSF038A05Sequence649007187 (4)gb:AY168617_15863802e-76Brassica napus putative ROP family GTPase (ROP9) mRNA, complete cds.886023791gb:NTA250174_16912831e-75Nicotiana tabacum mRNA for putative rac protein (rac gene).>gb:NTU64923_1691869
JMSF042O07Sequence648007187 (4)gb:AY168617_15863805e-67Brassica napus putative ROP family GTPase (ROP9) mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF008H10- AAAGCAACATCACTG
                      ____________________________________________________________
consensus AAAGCAACATCACTG
 
. : . : . : . : . : . :
rJMSF008H10- GTGCAGATTTGTTTCCCTAAATTGTTTCATTCATTACAGAAAGCAAATCAAAAGGGAGAG
                      ____________________________________________________________
consensus GTGCAGATTTGTTTCCCTAAATTGTTTCATTCATTACAGAAAGCAAATCAAAAGGGAGAG
 
. : . : . : . : . : . :
rJMSF008H10- GAGGAGGGCACAAGAGAGTGGCCTACAAAGTTGCTGGAGACCACAACAAAGAGACAAGAG
                      ____________________________________________________________
consensus GAGGAGGGCACAAGAGAGTGGCCTACAAAGTTGCTGGAGACCACAACAAAGAGACAAGAG
 
. : . : . : . : . : . :
rJMSF008H10- CCCAGCCACCTGACATTAGAACCTTCTTCCTCTTTCCTCTGAGACATAGGAAAGAGGAGA
                      ____________________________________________________________
consensus CCCAGCCACCTGACATTAGAACCTTCTTCCTCTTTCCTCTGAGACATAGGAAAGAGGAGA
 
. : . : . : . : . : . :
rJMSF008H10- AGGCAGGAAATGAGGGATACAGAAGAGGAGGAGAGTAGTGGTAAGTGTGATGGTATCCAC
                      ____________________________________________________________
consensus AGGCAGGAAATGAGGGATACAGAAGAGGAGGAGAGTAGTGGTAAGTGTGATGGTATCCAC
 
. : . : . : . : . : . :
rJMSF008H10- AGCCCTAATGGCTAATGCTGATCACAAAATAGAGCAAGACTTCTGAGTCTTGGCCTTCTT
                      ____________________________________________________________
consensus AGCCCTAATGGCTAATGCTGATCACAAAATAGAGCAAGACTTCTGAGTCTTGGCCTTCTT
 
. : . : . : . : . : . :
rJMSF008H10- TTTCTTCGCCTTGGGTGGTGCGAGCACAACTTTAATCGCAGCATCAAACACTCCTTTAAC
                      ____________________________________________________________
consensus TTTCTTCGCCTTGGGTGGTGCGAGCACAACTTTAATCGCAGCATCAAACACTCCTTTAAC
 
. : . : . : . : . : . :
rJMSF008H10- ATTCTCTTGTGTTTTTGAACTGCATTCAATGTAGGCAGGTGCAGCAATCGTTTTCTTGAG
                      ____________________________________________________________
consensus ATTCTCTTGTGTTTTTGAACTGCATTCAATGTAGGCAGGTGCAGCAATCGTTTTCTTGAG
 
. : . : . : . : . : . :
rJMSF008H10- CTCCTCTCCCTGAGCAGTGGTAATTGGCACAGCACCAGGATGGTCAACAAAGAACTGCTT
JMSF042O07+ TGAGCAGTGGTAATTGGCACAGCACCAGGATGGTCAACAAAGAACTGCTT
JMSF038A05+ TGAGCAGTGGTAATTGGCACAGCACCAGGATGGTCAACAAAGAACTGCTT
                      ____________________________________________________________
consensus CTCCTCTCCCTGAGCAGTGGTAATTGGCACAGCACCAGGATGGTCAACAAAGAACTGCTT
 
. : . : . : . : . : . :
rJMSF008H10- ATCATCCCGAAGATCAAGTTTAGTTCCAACAAGGACTATTGGAACACCAGGAGCATAATG
JMSF042O07+ ATCATCCCGAAGATCAAGTTTAGTTCCAACAAGGACTATTGGAACACCAGGAGCATAATG
JMSF038A05+ ATCATCCCGAAGATCAAGTTTAGTTCCAACAAGGACTATTGGAACACCAGGAGCATAATG
                      ____________________________________________________________
consensus ATCATCCCGAAGATCAAGTTTAGTTCCAACAAGGACTATTGGAACACCAGGAGCATAATG
 
. : . : . : . : . : . :
rJMSF008H10- TGTCAACTCAGGAATCCACTTTTTGGAAACATTCTCATAGCTGGCTTTACTAATGAGAGA
JMSF042O07+ TGTCAACTCAGGAATCCACTTTTTGGAAACATTCTCATAGCTGGCTTTACTAATGAGAGA
JMSF008H10+ CATAGCTGGCTTTACTAATGAGAGA
JMSF038A05+ TGTCAACTCAGGAATCCACTTTTTGGAAACATTCTCATAGCTGGCTTTACTAATGAGAGA
                      ____________________________________________________________
consensus TGTCAACTCAGGAATCCACTTTTTGGAAACATTCTCATAGCTGGCTTTACTAATGAGAGA
 
. : . : . : . : . : . :
rJMSF008H10- AAATGCCAAAATGAAAACATCAGCTCCACGGTAACTCAGAGGTCTTAGTCTATTATAATC
JMSF042O07+ AAATGCCAAAATGAAAACATCAGCTCCACGGTAACTCAGAGGTTTTAGTCTATTATAATC
JMSF008H10+ AAATGCCAAAATGAAAACATCAGCTCCACGGTAACTCAGAGGTCTTAGTCTATTATAATC
JMSF038A05+ AAATGCCAAAATGAAAACATCAGCTCCACGGTAACTCAGAGGTCTTAGTCTATTATAATC
                      ____________________________________________________________
consensus AAATGCCAAAATGAAAACATCAGCTCCACGGTAACTCAGAGGTCTTAGTCTATTATAATC
 
. : . : . : . : . : . :
rJMSF008H10- CTCCTGGCCAGCAGTATCCCACAAACCAAGGTTAACGGTACTCCCATTGACAACCACATT
JMSF042O07+ CTCNTGGCCAGCAGTATCCCACAAACCAAGGTTAACGGTACTCCCATTGACAACCACATT
JMSF008H10+ CTCCTGGCCAGCAGTATCCCACAAACCAAGGTTAACGGTACTCCCATTGACAACCACATT
JMSF038A05+ CTCCTGGCCAGCAGTATCCCACAAACCAAGGTTAACGGTACTCCCATTGACAACCACATT
                      ____________________________________________________________
consensus CTCCTGGCCAGCAGTATCCCACAAACCAAGGTTAACGGTACTCCCATTGACAACCACATT
 
. : . : . : . : . : . :
rJMSF008H10- GGCACTGAAANTGTCGAATACAGTTGGAACATAATCCGT
JMSF042O07+ GGCACTGAAATTGTNGAATACAGTTGGAACATAATCCGTGGGGAAAGTGTNGCTGGTGTA
JMSF008H10+ GGCACTGAAATTGTCGAATACAGTTGGAACATAATCCGTGGGGAAAGTGTTGCTGGTGTA
JMSF038A05+ GGCACTGAAATTGTCGAATACAGTTGGAACATAATCCGTGGGGAAAGTGTTGCTGGTGTA
                      ____________________________________________________________
consensus GGCACTGAAATTGTCGAATACAGTTGGAACATAATCCGTGGGGAAAGTGTTGCTGGTGTA
 
. : . : . : . : . : . :
JMSF042O07+ TGAAATAAGGAGGCAGGTCTTGCCAACAGCGCCATCACCCACCGTGACGCACTTGATGAA
JMSF008H10+ TGAAATAAGGAGGCAGGTCTTGCCAACAGCGCCATCACCCACCGTGACGCACTTGATGAA
JMSF038A05+ TGAAATAAGGAGGCAGGTCTTGCCAACAGCGCCATCACCCACCGTGACGCACTTGATGAA
                      ____________________________________________________________
consensus TGAAATAAGGAGGCAGGTCTTGCCAACAGCGCCATCACCCACCGTGACGCACTTGATGAA
 
. : . : . : . : . : . :
JMSF042O07+ CCTAGAAGCGCTCATTNTGAAGGCCTCAGATCTTCCTCCTCCTCAGAAGACCTGATTTTT
JMSF008H10+ CCTAGAAGCGCTCATTCTGAAGGCCTCAGATCTTCCTCCTCCTCAGAAGACCTGATTTTT
JMSF038A05+ CCTAGAAGCGCTCATTCTGAAGGCCTCAGATCTTCCTCCTCCTCAGAAGACCTGATTTTT
                      ____________________________________________________________
consensus CCTAGAAGCGCTCATTCTGAAGGCCTCAGATCTTCCTCCTCCTCAGAAGACCTGATTTTT
 
. : . : . : . : . : . :
JMSF042O07+ GCTTCTATAGCCACTCCAGTTCCCGGGGAAATGCCGCACGGAGGAAACAGAACCAACAAG
JMSF008H10+ GCTTCTATAGCCACTCCAGTTCCCGGGGAAATGCCGCACGGAGGAAACAGAACCAACAAG
JMSF038A05+ GCTTCTATAGCCACTCCAGTTCCCGGGGAAATGCCGCACGGAGGAAACAGAACCAACAAG
                      ____________________________________________________________
consensus GCTTCTATAGCCACTCCAGTTCCCGGGGAAATGCCGCACGGAGGAAACAGAACCAACAAG
 
. : . : . : . : . : . :
JMSF042O07+ GAGCGTCGCCGGGCTATAACCCTAACCCTTATTTTCGCCGTGAAATATTGCCTTTGAAT-
JMSF008H10+ GAGCGTCGCCGGGCTATAACCCTAACCCTTATTTTCGCCGTGAAATATTGCCTTTGAAT
JMSF038A05+ GAGCGTCGCCGGGCTATAACCCT-ACCCTTATTTTCGCCGTGAAATATTGCCTTTGAATC
                      ____________________________________________________________
consensus GAGCGTCGCCGGGCTATAACCCTAACCCTTATTTTCGCCGTGAAATATTGCCTTTGAATC
 
. : . : . : . : . : . :
JMSF042O07+ GTTCGNTGAAAGGTGAGAGAGACGACCGATCCAACAAGCCACCCACCAACCAATCT
JMSF038A05+ GTTCGCTGAAAGGTGAGAGAGACGACCGATCCAACAAGCCACCCACCAACCAATCTTTCC
                      ____________________________________________________________
consensus GTTCGCTGAAAGGTGAGAGAGACGACCGATCCAACAAGCCACCCACCAACCAATCTTTCC