Previous Contig 007184:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFN018O05Sequence615007184 (3)gb:AY127574_15804893e-78Arabidopsis thaliana ubiquitin-conjugating enzyme (UBC20) mRNA, complete cds.>gb
JMFN028G20Sequence567007184 (3)gb:AY127574_15804899e-64Arabidopsis thaliana ubiquitin-conjugating enzyme (UBC20) mRNA, complete cds.>gb
JMSF037O08Sequence639007184 (3)gb:AY127574_15804892e-72Arabidopsis thaliana ubiquitin-conjugating enzyme (UBC20) mRNA, complete cds.>gb714010136 (11)gb:AF209910_17773136e-48Prunus dulcis vacuolar sorting receptor protein mRNA, partial cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN018O05+ GTGACCCCCTCCTCGACAAACATCTCTNTGCGGCACCAATGAGCTTCAAGATGCT
                      ____________________________________________________________
consensus GTGACCCCCTCCTCGACAAACATCTCTNTGCGGCACCAATGAGCTTCAAGATGCT
 
. : . : . : . : . : . :
JMFN018O05+ AAAATCTACACAGCTGGTTTGTATAGCTTCTCAACCATCTTTCTGTATTCTTGTTGATTG
JMSF037O08+ ATAGCTTCTCAACCATCTTTCTGTACTCTTCTTGATTG
                      ____________________________________________________________
consensus AAAATCTACACAGCTGGTTTGTATAGCTTCTCAACCATCTTTCTGTATTCTTGTTGATTG
 
. : . : . : . : . : . :
JMFN018O05+ CCCCACAGCGATGCTGCCTGAGTGTTTAGAGGCGAGCTTGTGTTTGGTTCTCCAAGCAAA
JMFN028G20+ AGAGGCGAGCTGATGTTTGGCTCTCCTAGCAAA
JMSF037O08+ CCCCATAGCGCTGCCGCTTGAGAATTGAGAGGCGAGCTGATGTTTGGCTCTCCTAGCAAA
                      ____________________________________________________________
consensus CCCCATAGCGCTGCTGCTTGAGTGTTTAGAGGCGAGCTGATGTTTGGCTCTCCTAGCAAA
 
. : . : . : . : . : . :
JMFN018O05+ CTTTGAATAGAGAGCAGTATAGTCCTCACATCATAAGCAGATGACCATTTGTCCTGAAGG
JMFN028G20+ CTCTGGATTGAGAGTAGTATAGTCCTGACATCATATGCAGATGACCATTTGTCCTGAAGA
JMSF037O08+ CTCTGGATTGAGAGTAGTATAGTCCTGACATCATATGCAGATGACCATTTGTCCTGAAGA
                      ____________________________________________________________
consensus CTCTGGATTGAGAGTAGTATAGTCCTGACATCATATGCAGATGACCATTTGTCCTGAAGA
 
. : . : . : . : . : . :
JMFN018O05+ ATGTCCAAGCATATGTTCCCATACACATCAACGTTGGGATGAAAACAACCTGTCTCGAAC
JMFN028G20+ ATGTCCAAGCATATGTTCCCAAACACATCAACATTGGGATGAAAACAAGCAGTCTCGAAT
JMSF037O08+ ATGTCCAAGCATATGTTCCCAAACACATCAACATTGGGATGAAAACAAGCAGTCTCGAAT
                      ____________________________________________________________
consensus ATGTCCAAGCATATGTTCCCAAACACATCAACATTGGGATGAAAACAAGCAGTCTCGAAT
 
. : . : . : . : . : . :
JMFN018O05+ TTAACCTTGGGCGGTTTGAATGGATACTCATTTGGAAAGGCCAGAGAAAGCCTGTATTCT
JMFN028G20+ TTCACGGTGGGGGGTTTGAATGGATACTCGTTCGGGAAGGCAAGGGAGAGCTTGTATTCT
JMSF037O08+ TTCACGGTGGGGGGTTTGAATGGATACTCGTTCGGGAAGGCAAGGGAGAGCTTGTATTCT
                      ____________________________________________________________
consensus TTCACGGTGGGGGGTTTGAATGGATACTCGTTCGGGAAGGCAAGGGAGAGCTTGTATTCT
 
. : . : . : . : . : . :
JMFN018O05+ GTTCCTTCAAACACCGTGTCTTTGCTACCAGTGATCGTCCCTTTCCAGCAAAATATGTTG
JMFN028G20+ GTTCCTTCGAAAACAGTATCTTTGCTACCAGTGATTGTCCCTTTCCAGCAAAATATGTTG
JMSF037O08+ GTTCCTTCGAAAACAGTATCTTTGCTACCAGTGATTGTCCCTTTCCAGCAAAATATGTTG
                      ____________________________________________________________
consensus GTTCCTTCGAAAACAGTATCTTTGCTACCAGTGATTGTCCCTTTCCAGCAAAATATGTTG
 
. : . : . : . : . : . :
JMFN018O05+ TCTTCTTCAGGGAAAGCTGATATTCCTGAATCACCACTCATCATCAGGGCCATCAGTTCA
JMFN028G20+ TCTTCTTCAGGGAATGCTGATATTCCAGAATCACCACTCATCATCAAAGCCATCAGTTCG
JMSF037O08+ TCTTCTTCAGGGAATGCTGATATTCCAGAATCACCACTCATCATCAAAGCCATCAGTTCG
                      ____________________________________________________________
consensus TCTTCTTCAGGGAATGCTGATATTCCAGAATCACCACTCATCATCAAAGCCATCAGTTCG
 
. : . : . : . : . : . :
JMFN018O05+ GATTGCAGCCTTTTGAGAACGGATTGGGTGTCGACGGACTTAGC
JMFN028G20+ GATTGCAACCTTTTGAGAACGGACTGGGTGTCGACGGTCTTAGCTGGAGGCAGTGGCTTC
JMSF037O08+ GATTGCAACCTTTTGAGAACGGACTGGGTGTCGACGGTCTTAGCTGGAGGCAGTGGCTTC
                      ____________________________________________________________
consensus GATTGCAACCTTTTGAGAACGGACTGGGTGTCGACGGTCTTAGCTGGAGGCAGTGGCTTC
 
. : . : . : . : . : . :
JMFN028G20+ TTCGGTGACGGCATCACGGGGAGACTGTTAGGGTTGGTATTTGCCGCCGCCATTGCTACA
JMSF037O08+ TTCGGTGACGGCATCACGGGGAGACTGTTAGGGTTGGTATTTGCCGCCGCCATTGCTACA
                      ____________________________________________________________
consensus TTCGGTGACGGCATCACGGGGAGACTGTTAGGGTTGGTATTTGCCGCCGCCATTGCTACA
 
. : . : . : . : . : . :
JMFN028G20+ CAAATTCTTAATGATCTGAACCCGATAGAGAGAAAGACTCTTCCGGTACAGAATCAGAGA
JMSF037O08+ CAAATTCTTAATGATCTGAACCCGATAGAGAGAAAGACTCTTCCGGTACAGAATCAGAGA
                      ____________________________________________________________
consensus CAAATTCTTAATGATCTGAACCCGATAGAGAGAAAGACTCTTCCGGTACAGAATCAGAGA
 
. : . : . : . : . : . :
JMFN028G20+ GAGAAAGAGAGAAAAAAAGAGAGAGCGAGAGAGA
JMSF037O08+ GAGAAAGAGAGAAAAAAAGAGAGAGCGAGAGAGATTATCTGCCGGAAGAGTGTTCGGGTC
                      ____________________________________________________________
consensus GAGAAAGAGAGAAAAAAAGAGAGAGCGAGAGAGATTATCTGCCGGAAGAGTGTTCGGGTC