Previous Contig 007183:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFN006I14Sequence555007183 (5)gb:AB018120_15139003e-21Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MWJ3.>gb:AY065260_15664
JMFN014H11Sequence547007183 (5)gb:AB018120_15139003e-21Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MWJ3.>gb:AY065260_15664
JMFN033L03Sequence484007183 (5)gb:AB018120_15139002e-21Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MWJ3.>gb:AY065260_15664
JMFN040L13Sequence612007183 (5)gb:AB018120_15139004e-21Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MWJ3.>gb:AY065260_15664
JMSF037O07Sequence604007183 (5)gb:AB018120_15139004e-21Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MWJ3.>gb:AY065260_15664576023784gb:AB007644_15101373e-17Arabidopsis thaliana genomic DNA, chromosome 5, TAC clone:K19P17.>gb:BT015927_16

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN040L13+ CAAAAGAATTATGATGACNAGAGAC
                      ____________________________________________________________
consensus CAAAAGAATTATGATGACNAGAGAC
 
. : . : . : . : . : . :
JMFN033L03+ CTGTGAAGTATATCTATTACCAGATAAAG
JMFN006I14+ CTGTGAAGTATATCTATTACCAGATAAAG
JMFN040L13+ CATGGGTAGGTAAAGCAAACAGAAAGCTCATCTGTGAAGTATATCTATTACCAGATAAAG
JMFN014H11+ ATATCTATTACCAGATAAAG
JMSF037O07+ TAAAGCAAACAGAAAGCTCATCTGTGAAGTATATCTATTACCAGATAAAG
                      ____________________________________________________________
consensus CATGGGTAGGTAAAGCAAACAGAAAGCTCATCTGTGAAGTATATCTATTACCAGATAAAG
 
. : . : . : . : . : . :
JMFN033L03+ CATATATAGATATGTAAAATATCTTTTATGTCTTTTAAGATACCTGCACCCCACACTAAC
JMFN006I14+ CATATATAGATATGTAAAATATCTTTTATGTCTTTTAAGATACCTGCACCCCACACTAAC
JMFN040L13+ CATATATAGATATGTAAAATATCTTTTATGTCTTTTAAGATACCTGCACCCCACACTAAC
JMFN014H11+ CATATATAGATATGTAAAATATCTTTTATGTCTTTTAAGATACCTGCACCCCACACTAAC
JMSF037O07+ CATATATAGATATGTAAAATATCTTTTATGTCTTTTAAGATACCTGCACCCCACACTAAC
                      ____________________________________________________________
consensus CATATATAGATATGTAAAATATCTTTTATGTCTTTTAAGATACCTGCACCCCACACTAAC
 
. : . : . : . : . : . :
JMFN033L03+ ATAATTTTACATGATAAAATAGATTCCAGCAGAAGAACACAAGAGCCTCCGGCTCCTCTT
JMFN006I14+ ATAATTTTACATGATAAAATAGATTCCAGCAGAAGAACACAAGAGCCTCCGGCTCCTCTT
JMFN040L13+ ATAATTTTACATGATAAAATAGATTCCAGCAGAAGAACACAAGAGCCTCCGGCTCCTCTT
JMFN014H11+ ATAATTTTACATGATAAAATAGATTCCAGCAGAAGAACACAAGAGCCTCCGGCTACTCTT
JMSF037O07+ ATAATTTTACATGATAAAATAGATTCCAGCAGAAGAACACAAGAGCCTCCGGCTCCTCTT
                      ____________________________________________________________
consensus ATAATTTTACATGATAAAATAGATTCCAGCAGAAGAACACAAGAGCCTCCGGCTCCTCTT
 
. : . : . : . : . : . :
JMFN033L03+ GTAAATGGAAAACGCCAAATTGATTATGGATATTCAATCCCATTTTCAGCTTTTCGCCTT
JMFN006I14+ GTAAATGGAAAACGCCAAATTGATTATGGATATTCAATCCCATTTTCAGCTTTTCGCCTT
JMFN040L13+ GTAAATGGAAAACGCCAAATTGATTATGGATATTCAATCCCATTTTCAGCTTTTCGCCTT
JMFN014H11+ GTAAATGGAAAACGCCAAATTGATTATGGATATTCAATCCCATTTTCAGCTTTTCGCCTT
JMSF037O07+ GTAAATGGAAAACGCCAAATTGATTATGGATATTCAATCCCATTTTCAGCTTTTCGCCTT
                      ____________________________________________________________
consensus GTAAATGGAAAACGCCAAATTGATTATGGATATTCAATCCCATTTTCAGCTTTTCGCCTT
 
. : . : . : . : . : . :
JMFN033L03+ TTCCACAGCCTTGTCAAGAATCCACATGAGGGTTCTGTATGCAGCAAAACCATTTTTTAG
JMFN006I14+ TTCCACAGCCTTGTCAAGAATCCACATGAGGGTTCTGTATGCAGCAAAACCATTTTTTAG
JMFN040L13+ TTCCACAGCCTTGTCAAGAATCCACATGAGGGTTCTGTATGCAGCAAAACCATTTTTTAG
JMFN014H11+ TTCCACAGCCTTGTCAAGAATCCACATGAGGGTTCTGTATGCAGCAAAACCATTTTTTAG
JMSF037O07+ TTCCACAGCCTTGTCAAGAATCCACATGAGGGTTCTGTATGCAGCAAAACCATTTTTTAG
                      ____________________________________________________________
consensus TTCCACAGCCTTGTCAAGAATCCACATGAGGGTTCTGTATGCAGCAAAACCATTTTTTAG
 
. : . : . : . : . : . :
JMFN033L03+ CCGGTGGTTTTGATGGATCTGCTGCAGGTTTAGTGTTGGAATCAGCCTTTGATGGTGATT
JMFN006I14+ CCGGTGGTTTTGATGGATCTGCTGCAGGTTTAGTGTTGGAATCAGCCTTTGATGGTGATT
JMFN040L13+ CCGGTGGTTTTGATGGATCTGCTGCAGGTTTAGTGTTGGAATCAGCCTTTGATGGTGATT
JMFN014H11+ CCGGTGGTTTTGATGGATCTGCTGCAGGTTTAGTGTTGGAATCAGCCTTTGATGGTGATT
JMSF037O07+ CCGGTGGTTTTGATGGATCTGCTGCAGGTTTAGTGTTGGAATCAGCCTTTGATGGTGATT
                      ____________________________________________________________
consensus CCGGTGGTTTTGATGGATCTGCTGCAGGTTTAGTGTTGGAATCAGCCTTTGATGGTGATT
 
. : . : . : . : . : . :
JMFN033L03+ CAGGCTTACCACCCGTTTTCTTTTCATCCCTGGCCTTGTTAAAAATCACAGTAAATCCTT
JMFN006I14+ CAGGCTTACCACCCGTTTTCTTTTCATCCCTGGCCTTGTTAAAAATCACAGTAAATCCTT
JMFN040L13+ CAGGCTTACCACCCGTTTTCTTTTCATCCCTGGCCTTGTTAAAAATCACAGTAAATCCTT
JMFN014H11+ CAGGCTTACCACCCGTTTTCTTTTCATCCCTGGCCTTGTTAAAAATCACAGTAAATCCTT
JMSF037O07+ CAGGCTTACCACCCGTTTTCTTTTCATCCCTGGCCTTGTTAAAAATCACAGTAAATCCTT
                      ____________________________________________________________
consensus CAGGCTTACCACCCGTTTTCTTTTCATCCCTGGCCTTGTTAAAAATCACAGTAAATCCTT
 
. : . : . : . : . : . :
JMFN033L03+ CTGCTGAAGCTGGGTCGTTAACATCCCATTCACCAAACTTTGGCAAGGGTCGACCCTTCT
JMFN006I14+ CTGCTGAAGCTGGGTCGTTAACATCCCATTCACCAAACTTTGGCAAGGGTCGACCCTTCT
JMFN040L13+ CTGCTGAAGCTGGGTCGTTAACATCCCATTCACCAAACTTTGGCAAGGGTCGACCCTTCT
JMFN014H11+ CTGCTGAAGCTGGGTCGTTAACATCCCATTCACCAAACTTTGGCAAGGGTCGACCCTTCT
JMSF037O07+ CTGCTGAAGCTGGGTCGTTAACATCCCATTCACCAAACTTTGGCAAGGGTCGACCCTTCT
                      ____________________________________________________________
consensus CTGCTGAAGCTGGGTCGTTAACATCCCATTCACCAAACTTTGGCAAGGGTCGACCCTTCT
 
. : . : . : . : . : . :
JMFN033L03+ CTTCCGACATGAATCCACTCACTAGATGAGTCTTG
JMFN006I14+ CTTCCGACATGAATCCACTCACTAGATGAGTCTTGCTGGAAAATGAATTGTGCTATTGGC
JMFN040L13+ CTTCCGACATGAATCCACTCACTAGATGAGTCTTGCTGGAAAATGAATTGTGCTATTGGC
JMFN014H11+ CTTCCGACATGAATCCACTCACTAGATGAGTCTTGCTGGAAAATGAATTGTGCTATTGGC
JMSF037O07+ CTTCCGACATGAATCCACTCACTAGATGAGTCTTGCTGGAAAATGAATTGTGCTATTGGC
                      ____________________________________________________________
consensus CTTCCGACATGAATCCACTCACTAGATGAGTCTTGCTGGAAAATGAATTGTGCTATTGGC
 
. : . : . : . : . : . :
JMFN006I14+ AGAGGGAGAGAAAGCGAGCAAGAGAGAGAGAGAGAGAGAGAGAAAG
JMFN040L13+ AGAGGGAGAGAAAGCGAGCAAGAGAGAGAGAGAGAGAGAGAGAAAG
JMFN014H11+ AGAGGGAGAGAAAGCGAGCAAGAGAGAGAGAGAGAGAGAGAGAAAG
JMSF037O07+ AGAGGGAGAGAAAGCGAGCAAGAGAGAGAGAGAGAGAGAGAGAAAGAGAGAGAAATTGCC
                      ____________________________________________________________
consensus AGAGGGAGAGAAAGCGAGCAAGAGAGAGAGAGAGAGAGAGAGAAAGAGAGAGAAATTGCC