Previous Contig 007179:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF001F10Sequence604007179 (14)gb:AB023038_15154132e-42Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MIE1.>gb:AY050827_1562788008177 (13)gb:AB023038_15154081e-63Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MIE1.
JMFF008H11Sequence578007179 (14)gb:AB023038_15154084e-46Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MIE1.835008177 (13)gb:AB023038_15154081e-88Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MIE1.
JMFF021M21Sequence538007179 (14)gb:AB023038_15154135e-40Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MIE1.>gb:AY050827_1562
JMFF024I22Sequence409007179 (14)sp|Q05047|CP72_CATRO2e-31Cytochrome P450 72A1 (EC 1.3.3.9) (CYPLXXII) (Secologanin synthase) (SLS).>pir|T735008177 (13)gb:AB023038_15154087e-80Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MIE1.
JMFF032K13Sequence527007179 (14)gb:AB023038_15154134e-46Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MIE1.>gb:AY050827_1562650008177 (13)gb:AB023038_15154083e-58Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MIE1.
JMFF044I22Sequence640007179 (14)gb:AB023038_15154133e-45Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MIE1.>gb:AY050827_1562503008177 (13)gb:AB023038_15154089e-58Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MIE1.
JMFF049K24Sequence619007179 (14)gb:AB023038_15154131e-46Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MIE1.>gb:AY050827_1562614008177 (13)gb:AB023038_15154083e-52Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MIE1.
JMFF050G03Sequence622007179 (14)gb:AB023038_15154133e-44Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MIE1.>gb:AY050827_1562489008177 (13)gb:AB023038_15154088e-40Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MIE1.
JMFF051C20Sequence490007179 (14)sp|Q05047|CP72_CATRO5e-34Cytochrome P450 72A1 (EC 1.3.3.9) (CYPLXXII) (Secologanin synthase) (SLS).>pir|T254008177 (13)
JMFS077E10Sequence624007179 (14)gb:AB023038_15154131e-45Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MIE1.>gb:AY050827_1562
JMSF009P16Sequence173007179 (14)sp|Q05047|CP72_CATRO4e-04Cytochrome P450 72A1 (EC 1.3.3.9) (CYPLXXII) (Secologanin synthase) (SLS).>pir|T271008177 (13)gb:AB023038_15154126e-14Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MIE1.>gb:BT001008_1635
JMSF037N24Sequence681007179 (14)gb:AB023038_15154132e-47Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MIE1.>gb:AY050827_1562664008177 (13)gb:AB023038_15154085e-74Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MIE1.
JMSF038A22Sequence694007179 (14)gb:AB023038_15154133e-57Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MIE1.>gb:AY050827_1562860008177 (13)gb:AB023038_15154085e-88Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MIE1.
JMSF043G14Sequence790007179 (14)gb:AB023038_15154135e-64Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MIE1.>gb:AY050827_1562776008177 (13)gb:AB023038_15154085e-81Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MIE1.

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF043G14+ ATCTCA
                      ____________________________________________________________
consensus ATCTCA
 
. : . : . : . : . : . :
JMSF043G14+ ATCCAGGTATATAAACTTGACGCGTAGTTTCCACCAAGTGCATGGCCTGTTCTTTCAGAA
                      ____________________________________________________________
consensus ATCCAGGTATATAAACTTGACGCGTAGTTTCCACCAAGTGCATGGCCTGTTCTTTCAGAA
 
. : . : . : . : . : . :
JMSF043G14+ GCTCAAAGATCCTCTTTCCTTCTTCATAGCTGCTCCCAAACGCTGTTCGAGAAATCACAT
JMSF038A22+ TGCTCCCAAACGCTGTTCGAGAAATCACAT
                      ____________________________________________________________
consensus GCTCAAAGATCCTCTTTCCTTCTTCATAGCTGCTCCCAAACGCTGTTCGAGAAATCACAT
 
. : . : . : . : . : . :
JMSF043G14+ CACAGGTTAGGCCTTGAAGGTGAGGCCACACATCCACCTCACAAGAACAAGATGATGATC
JMFF044I22+ AGGCCACACATCCACCTCACAAGAACAAGATGATGATC
JMFF049K24+ CACAAGAACAAGATGATGATC
JMFF050G03+ CAAGAACAAGATGATGATC
JMFF032K13+ ATC
JMSF038A22+ CACAGGTTAGGCCTTGAAGGTGAGGCCACACATCCACCTCACAAGAACAAGATGATGATC
JMSF037N24+ GATGATGATC
                      ____________________________________________________________
consensus CACAGGTTAGGCCTTGAAGGTGAGGCCACACATCCACCTCACAAGAACAAGATGATGATC
 
. : . : . : . : . : . :
JMSF043G14+ CTTTTCCATACACAATTCCCTCTCACTTGCTCAGCATTTCAGAGCAGCTTAGCAAGAAAG
JMFF044I22+ C-TTTCCATACACAATTCCCTCCCACTTGCTCAGCATTTCAGAGCAGCTTAGCAAGAAAG
JMFF049K24+ CTTTTCCATACACAATTCCCTCCCACTTGCTCAGCATTCGAGAGCAGCTTAGCAAGAAAG
JMFF050G03+ CTTTTCCATACACAATTCCCTCNCACTGCTNCAGCATNTCAGAGCAGCTTAGCAAGAAAG
JMFF032K13+ CTTTTCCATACACAATTCCCTCCCACTTGCTCAGCATTTCAGAGCAGCTTAGCAAGAAAG
JMSF038A22+ CTTTTCCATACACAATTCCCTCCCACTTGCTCAGCATTTCAGAGCAGCTTAGCAAGAAAG
JMFF008H11+ CCCACTTGCTCAGCATTTCAGAGCAGCTTAGCAAGAAAG
JMFF001F10+ CAGAGCAGCTTAGCAAGAAAG
JMFS077E10+ CTTTTCCATACACAATTCCCTCCCACTTGCTCAGCATTTCAGAGCAGCTTAGCAAGAAAG
JMSF037N24+ CTTTTCCATACACAATCCCTTCCCACTTGCTCAGCATTTCAGAGCAGCTTAGCAAGAAAG
                      ____________________________________________________________
consensus CTTTTCCATACACAATTCCCTCCCACTTGCTCAGCATTTCAGAGCAGCTTAGCAAGAAAG
 
. : . : . : . : . : . :
JMSF043G14+ CCGGTTGCATAAGCTTTGGCTTCTCCGAATAGAAGGCAGGATTGAGTAGTCTTCTGTGTT
JMFF044I22+ CCGGTTGCATAAGCTTTAGCTTCTCCGAATAGAAGGCAGGATTGAGTAGTCTTCTGTGTT
JMFF049K24+ CCGGTTGCATAAGCTTTAGCTTCTCCGAATAGAAGGCAGGATTGAGTAGTCTTCTGTGTT
JMFF050G03+ CCGGTTGCATAAGCTNTAGCTTCTCCGAATAGAAGGCAGGATTGAGTAGTCTTCTGTGTT
JMFF032K13+ CCGGTTGCATAAGCTTTAGCTTCTCCGAATAGAAGGCAGGATTGAGTAGTCTTCTGTGTT
JMSF038A22+ CCGGTTGCATAAGCTTTAGCTTCTCCGAATAGAAGGCAGGATTGAGTAGTCTTCTGTGTT
JMFF008H11+ CCGGTTGCATAAGCTTTAGCTTCTCGGAATAGAAGGCAGGATTGAGTAGTCTTCTGTGTT
JMFF051C20+ CTGTGTT
JMFF021M21+ TGCATAAGCTTTAGCTTCTCCGAATAGAAGGCAGGATTGAGTAGTCTTCTGTGTT
JMFF001F10+ CCGGTTGCATAAGCTTTAGCTTCTCCGAATAGAAGGCAGGATTGAGTAGTCTTCTGTGTT
JMFS077E10+ CCGGTTGCATAAGCTTTAGCTTCTCCGAATAGAAGGCAGGATTGAGTAGTCTTCTGTGTT
JMSF037N24+ CCGGTTGCATAAGCTTTAGCTTCTCGGAATAGAAGGCAGGATTGAGTAGTCTTCTGTGTT
                      ____________________________________________________________
consensus CCGGTTGCATAAGCTTTAGCTTCTCCGAATAGAAGGCAGGATTGAGTAGTCTTCTGTGTT
 
. : . : . : . : . : . :
JMSF043G14+ TTGCCCACTGCTCTTTCTCATAACTGACAAGTCCTCGTACCAACTTTCTGCCCAGTGGAT
JMFF044I22+ TTGCCCACTGCTCTTTCTCATAACTGACAAGTCCTCGTACCAACTTTCTGCCCAGTGGAT
JMFF049K24+ TTGCCCACTGCTCTTTCTCATAACTGACAAGTCCTCGTACCAACTTTCTGCCCAGTGGAT
JMFF050G03+ TTGCCCACTGCTCTTTCTCATAACTGACAAGTCCTCGTACCAACTTTCTGCCCAGTGGAT
JMFF032K13+ TTGCCCACTGCTCTTTCTCATAACTGACAAGTCCTCGTACCAACTTTCTGCCCAGTGGAT
JMSF038A22+ TTGCCCACTGCTCTTTCTCATAACTGACAAGTCCTCGTACCAACTTTCTGCCCAGTGGAT
JMFF008H11+ TTGCCCACTGCTCTTTCTCATAGCTCACAAGTCCTCGTGCCAACTTCCTGCCCAGTGGAT
JMFF051C20+ TTGCCCACTGCTCTTTCTCATAACTGACAAGTCCTCGTACCAACTTTCTGCCCAGTGGAT
JMFF021M21+ TTGCCCACTGCTCTTTCTCATAACTGACAAGTCCTCGTACCAACTTTCTGCCCAGTGGAT
JMFF001F10+ TTGCCCACTGCTCTTTCTCATAACTGACAAGTCCTCGTACCAACTTTCTGCCCAGTGGAT
JMFS077E10+ TTGCCCACTGCTCTTTCTCATAACTGACAAGTCCTCGTACCAACTTTCTGCCCAGTGGAT
JMSF037N24+ TTGCCCACTGCTCTTTCTCATAGCTCACAAGTCCTCGTGCCAACTTCCTGCCCAGTGGAT
                      ____________________________________________________________
consensus TTGCCCACTGCTCTTTCTCATAACTGACAAGTCCTCGTACCAACTTTCTGCCCAGTGGAT
 
. : . : . : . : . : . :
JMSF043G14+ TGTTCCTAGGCTTCTGAAACAGTTCATATTTATTCAAAACCTCCTTTACTAGCTCAGGAT
JMFF044I22+ TGTTCCTAGGCTTCTGAAACAGTTCATATTTATTCAAAACCTCCTTTACTAGCTCAGGAT
JMFF049K24+ TGTTCCTAGGCTTCTGAAACAGTTCATATTTATTCAAAACCTCCTTTACTAGCTCAGGAT
JMFF050G03+ TGTTCCTAGGCTTCTGAAACAGTTCATATTTATTCAAAACCTCCTTTACTAGCTCAGGAT
JMFF032K13+ TGTTCCTAGGCTTCTGAAACAGTTCATATTTATTCAAAACCTCCTTTACTAGCTCAGGAT
JMSF038A22+ TGTTCCTAGGCTTCTGAAACAGTTCATATTTATTCAAAACCTCCTTTACTAGCTCAGGAT
JMFF024I22+ CTTCTGAAACAGTTCATATTTATTCAAAACCTCCTTTACTAGCTCAGGAT
JMFF008H11+ TGTTCCTAGGCTTCTGAAACAGTTCATATTTATTCAAAACCTCCTTTACTAGCTCAGGAT
JMFF051C20+ TGTTCCTAGGCTTCTGAAACAGTTCATATTTATTCAAAACATCCTTTACTAGCTCAGGAT
JMFF021M21+ TGTTCCTAGGCTTCTGAAACAGTTCATATTTATTCAAAACCTCCTTTACTAGCTCAGGAT
JMFF001F10+ TGTTCCTAGGCTTCTGAAACAGTTCATATTTATTCAAAACCTCCTTTACTAGCTCAGGAT
JMFS077E10+ TGTTCCTAGGCTTCTGAAACAGTTCATATTTATTCAAAACCTCCTTTACTAGCTCAGGAT
JMSF037N24+ TGTTCCTAGGCTTCTGAAACAGTTCATATTTATTCAAAACCTCCTTTACTAGCTCAGGAT
                      ____________________________________________________________
consensus TGTTCCTAGGCTTCTGAAACAGTTCATATTTATTCAAAACCTCCTTTACTAGCTCAGGAT
 
. : . : . : . : . : . :
JMSF043G14+ CCCTGATGAACACCATTGGCATTGGACCCATCCATACATAACAGTTTTTACCGTATTTGT
JMFF044I22+ CCCTGATGAACACCATTGGCATTGGACCCATCCATACATAACAGTTTTTACCGTATTTGT
JMFF049K24+ CCCTGATGAACACCATTGGCATTGGACCCATCCATACATAACAGTTTTTACCGTATTTGT
JMFF050G03+ CCCTGATGAACACCATTGGCATTGGACCCATCCATACATAACAGTTTTTACCGTATTTGT
JMFF032K13+ CCCTGATGAACACCATTGGCATTGGACCCATCCATACATAACAGTTTTTACCGTATTTGT
JMSF038A22+ CCCTGATGAACACCATTGGCATTGGACCCATCCATACATAACAGTTTTTACCGTATTTGT
JMFF024I22+ CCCTGATGAACACCATTGGCATTGGACCCATCCATACATAACAGTTTTTACCGTATTTGT
JMFF008H11+ CCCTGATGAACACCATTGGCATTGGACCCATCCATACATAACAGTTTTTACCGTATTTGT
JMFF051C20+ CCCTGATGAACACCATTGGCATTGGACCCATCCATACATAACAGTTTTTACCGTATTTGT
JMFF021M21+ CCCTGATGAACACCATTGGCATTGGACCCATCCATACATAACAGTTTTTACCGTATTTGT
JMFF001F10+ CCCTGATGAACACCATTGGCATTGGACCCATCCATACATAACAGTTTTTACCGTATTTGT
JMFS077E10+ CCCTGATGAACACCATTGGCATTGGACCCATCCATACATAACAGTTTTTACCGTATTTGT
JMSF037N24+ CCCTGATGAACACCATTGGCATTGGACCCATCCATACATAACAGTTTTTACCGTATTTGT
                      ____________________________________________________________
consensus CCCTGATGAACACCATTGGCATTGGACCCATCCATACATAACAGTTTTTACCGTATTTGT
 
. : . : . : . : . : . :
JMSF043G14+ CGGCTAGGTGAGCATAATACGGGATAACTCTCGGGGCTACGTTATCCGACAGAGTCATGG
JMFF044I22+ CGGCTAGGTGAGCATAATACGGGATAACTCTCGGGGCTACGTTATCCGACAGAGTCATGG
JMFF049K24+ CGGCTAGGTGAGCATAATACGGGATAACTCTCGGGGCTACGTTATCCGACAGAGTCATGG
JMFF050G03+ CGGCTAGGTGAGCATAATACGGGATAACTCTCGGGGCTACGTTATCCGACAGAGTCATGG
JMFF032K13+ CGGCTAGGTGAGCATAATACGGGATAACTCTCGGGGCTACGTTATCCGACAGAGTCATGG
JMSF038A22+ CGGCTAGGTGAGCATAATACGGGATAACTCTCGGGGCTACGTTATCCGACAGAGTCATGG
JMFF024I22+ CGGCGAGGTGAACATAATAGGGAATGACTCTGGGGGCTATGTTATCCGACAGAGTCATGG
JMFF008H11+ CGGCGAGGTGAACATAATAGGGAATGACTCTGGGGGCTATGTTATCCGACAGAGTCATGG
JMFF051C20+ CGGCTAGGTGAGCATAATACGGGATAACTCTCGGGGCTACGTTATCCGACAGAGTCATGG
JMFF021M21+ CGGCTAGGTGAGCATAATACGGGATAACTCTCGGGGCTACGTTATCCGACAGAGTCATGG
JMFF001F10+ CGGCTAGGTGAGCATAATACGGGATAACTCTCGGGGCTACGTTATCCGACAGAGTCATGG
JMFS077E10+ CGGCTAGGTGAGCATAATACGGGATAACTCTCGGGGCTACGTTATCCGACAGAGTCATGG
JMSF037N24+ CGGCGAGGTGAACATAATAGGGAATGACTCTGGGGGCTATGTTATCCGACAGAGTCATGG
                      ____________________________________________________________
consensus CGGCTAGGTGAGCATAATACGGGATAACTCTCGGGGCTACGTTATCCGACAGAGTCATGG
 
. : . : . : . : . : . :
JMSF043G14+ GCTTGGAAATGGCGTCACTCGCCATCTTCACGAGCTCTTTCATGTCGCCGGAGAGGATTC
JMFF044I22+ GCTTGGAAATGGCGTCACTCGCCATCTTCACGAGCTCTTTCATGTCGCCGGAGAGGATTC
JMFF049K24+ GCTTGGAAATGGCGTCACTCGCCATCTTCACGAGCTCTTTCATGTCGCCGGAGAGGATTC
JMFF050G03+ GCTTGGAAATGGCGTCACTCGCCATCTTCACGAGCTCTTTCATGTCGCCGGAGAGGATTC
JMFF032K13+ GCTTGGAAATGGCGTCACTCGCCATCTTCACGAGCTCTTTCATGTCGCCGGAGAGGATTC
JMSF038A22+ GCTTGGAAATGGCGTCACTCGCCATCTTCACGAGCTCTTTCATGTCGCCGGAGAGGATTC
JMFF024I22+ GCTTGGAAAGAGCGTCAGTCGTCATCTTCGCGAGCTCTTTCATGTCGCCGGAGAGGATTC
JMFF008H11+ GCTTGGAAAGAGCGTCAGTCGTCATCTTCGCGAGCTCTTTCATGTCGCCGGAGAGGATTC
JMFF051C20+ GCTTGGAAATGGCGTCACTCGCCATCTTCACGAGCTCTTTCATGTCGCCGGAGAGGATTC
JMFF021M21+ GCTTGGAAATGGCGTCACTCGCCATCTTCACGAGCTCTTTCATGTCGCCGGAGAGGATTC
JMFF001F10+ GCTTGGAAATGGCGTCACTCGCCATCTTCACGAGCTCTTTCATGTCGCCGGAGAGGATTC
JMFS077E10+ GCTTGGAAATGGCGTCACTCGCCATCTTCACGAGCTCTTTCATGTCGCCGGAGAGGATTC
JMSF037N24+ GCTTGGAAAGAGCGTCAGTCGTCATCTTCGCGAGCTCTTTCATGTCGCCGGAGAGGATTC
                      ____________________________________________________________
consensus GCTTGGAAATGGCGTCACTCGCCATCTTCACGAGCTCTTTCATGTCGCCGGAGAGGATTC
 
. : . : . : . : . : . :
JMSF043G14+ TGTAGGGGTTCCCTTTGAGGCCTAGCTGTTTTAGGCACTTCTCCAGCTTCTTCGGCTTAA
JMFF044I22+ TGTAGGGGTTCCCTTTGAGGCCTAGCTGTTTTAGGCACTTCTCCAGCTTCTTCGGCTGTA
JMFF049K24+ TGTAGGGGTTCCCTTTGAGGCCTAGCTGTTTTAGGCACTTCTCCAGCTTCTTCGGCTTAA
JMFF050G03+ TGTAGGGGTTCCCTTTGAGGCCTAGCTGTTTTAGGCACTTCTCCAGCTTCTTCGGCTTAA
JMFF032K13+ TGTAGGGGTTCCCTTTGAGGCCTAGCTGTTTTAGGCACTTCTCCAGCTTCTTCGGCTTAA
JMSF038A22+ TGTAGGGGTTCCCTTTGAGGCCTAGCTGTTTTAGGCACTTCTCCAGCTTCTTCGGCTTAA
JMFF024I22+ TGTAGGGGTTCCCTTTGAGGCCTTGCTGTTTTAGGCACTTCTCCAGCTTCTTCGGCTTAA
JMFF008H11+ TGTAGGGGTTCCCTTTGAGGCCTTGCTGTTTTAGGCACTTCTCCAGCTTCTTCGGCTTAA
JMFF051C20+ TGTAGGGGTTCCCTTTGAGGCCTAGCTGTTTTAGGCACTTCTCCAGCTTCTTCGGCTTAA
JMFF021M21+ TGTAGGGGTTCCCTTTGAGGCCTAGCTGTTTTAGGCACTTCTCCAGCTTCTTCGGCTTAA
JMFF001F10+ TGTAGGGGTTCCCTTTGAGGCCTAGCTGTTTTAGGCACTTCTCCAGATTCTTCGGCTTAA
JMSF009P16+ GCCTAGCTGTTTTAGGCACTTCTCCAGCTTCTTCGGCTTAA
JMFS077E10+ TGTAGGGGTTCCCTTTGAGGCCTAGCTGTTTTAGGCACTTCTCCAGCTTCTTCGGCTTAA
JMSF037N24+ TGTAGGGGTTCCCTTTGAGGCCTTGCTGTTTTAGGCACTTCTCCAGCTTCTTCGGCTTAA
                      ____________________________________________________________
consensus TGTAGGGGTTCCCTTTGAGGCCTAGCTGTTTTAGGCACTTCTCCAGCTTCTTCGGCTTAA
 
. : . : . : . : . : . :
JMSF043G14+ ACCACACCCAACCCAACACTCTCCATGCGAACGCCAACAAACCCACCGAAACGCACACTC
JMFF044I22+ ACCACACCCAACCCAACACTCTCCATGCGAACGCCAACAAACCCACCGAAACGCACACTC
JMFF049K24+ ACCACACCCAACCCAACACTCTCCATGCGAACGCCAACAAACCCACCGAAACGCACACTC
JMFF050G03+ ACCACACCCAACCCAACACTCTCCATGCGAACGCCAACAAACCCACCGAAACGCACACTC
JMFF032K13+ ACCACACCCAACCCAACACTCTCCATGCGAACGCCAACAAACCC
JMSF038A22+ ACCACACCCAACCCAACACTCTCCATGCGAACGCCAACAAACCCACCGAAACGCACACTC
JMFF024I22+ ACCACACCCAACCCAACACTCTCCATGCGAACGCCAACAAACCCACTGAAACGCACACTC
JMFF008H11+ ACCACACCCAACCCAACACTCTCCATGCGAACGCCAACAAACCCACTGAAACGCACACTC
JMFF051C20+ ACCACACCCAACCCAACACTCTCCATGCGAACGCCAACAAACCCACCGAAACGCACACTC
JMFF021M21+ ACCACACCCAACCCAACACTCTCCATGCGAACGCCAACAAACCCACCGAAACGCACACTC
JMFF001F10+ ACCACACCCAACCCAACACTCTCCATGCGAACGCCAACAAACCCACCGAAACGCACACTC
JMSF009P16+ ACCACACCCAACCCAACACTCTCCATGCGAACGCCAACAAACCCACCGAAACGCACACTC
JMFS077E10+ ACCACACCCAACCCAACACTCTCCATGCGAACGCCAACAAACCCACCGAAACGCACACTC
JMSF037N24+ ACCACACCCAACCCAACACTCTCCATGCGAACGCCAACAAACCCACTGAAACGCACACTC
                      ____________________________________________________________
consensus ACCACACCCAACCCAACACTCTCCATGCGAACGCCAACAAACCCACCGAAACGCACACTC
 
. : . : . : . : . : . :
JMSF043G14+ CCAGTAGGGTGTATATCACCTCCATCTATATCCGTCGAGGTCACCGGAACTGTGGGAGTT
JMFF044I22+ CCAGTAGGGTGTATATCACCTCCATCTATATCCGTCGAGGTCACCGGAACTGTGGGAGTT
JMFF049K24+ CCAGTAGGGTGTATATCACCTCCATCTATATCCGTCGAGGTCACCGGAACTGTGGGAG
JMFF050G03+ CCAGTAGGGTGTATATCACCTCCATCTATATCCGTCGAGGTCACCGGAACTGTGGGAGTT
JMSF038A22+ CCAGTAGGGTGTATATCACCTCCATCTATATCCGTCGAGGTCACCGGAACTGTGGGAGTT
JMFF024I22+ CCAGTAGGGTGTATATCACCTCCATC----TCCGTCCAGGCCATCGGAACTGTGGGAGTT
JMFF008H11+ CCAGTAGGGTGTATATCACCTCCATC----TCCGTCCAGGCCATCGGAACTGTGGGAGTT
JMFF051C20+ CCAGTAGGGTGTATATCACCTCCATCTATATCCGTCGAGGTCACCGGAACTGTGGGAGTT
JMFF021M21+ CCAGTAGGGTGTATATCACCTCCATCTATATCCGTCGAGGTCACCGGAACTGTGGGAGTT
JMFF001F10+ CCAGTAGGGTGTATATCACCTCCATCT
JMSF009P16+ CCAGTAGGGTGTATATTACCTCCATCTATATCCGTCGAGGTCACCGGAACTGTGGGAGTT
JMFS077E10+ CCAGTAGGGTGTATATCACCTCCATCTATATCCGTCGAGGTCACCGGAACTGTGGGAGTT
JMSF037N24+ CCAGTAGGGTGTATATCACCTCCATC----TCCGTCCAGGCCATCGGAACTGTGGGAGTT
                      ____________________________________________________________
consensus CCAGTAGGGTGTATATCACCTCCATCTATATCCGTCGAGGTCACCGGAACTGTGGGAGTT
 
. : . : . : . : . : . :
JMSF043G14+ CT
JMFF044I22+ CTT
JMFF050G03+ CTT
JMSF038A22+ CTT
JMFF024I22+ CTT
JMFF008H11+ CTT
JMFF051C20+ CTT
JMFF021M21+ CTT
JMSF009P16+ CTTGATTTCAC
JMFS077E10+ CTTGATTTCACGG
JMSF037N24+ CTTGATTTCACGGCGGGTAACCGGCTTTCATATATAAATTTCTTCTTATGAAGACTGTTC
                      ____________________________________________________________
consensus CTTGATTTCACGGCGGGTAACCGGCTTTCATATATAAATTTCTTCTTATGAAGACTGTTC