Previous Contig 007177:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF007P13Sequence121007177 (4)153020808
JMSF001N11Sequence664007177 (4)gb:AP005644_18553416e-07Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OSJN
JMSF037N09Sequence666007177 (4)gb:AP005644_18553450.002Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OSJN606007177 (4)gb:AP005644_18553450.006Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OSJN

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF007P13+ TTTTTTTTTTCTTTTTTGAATATGCAATCCC
                      ____________________________________________________________
consensus TTTTTTTTTTCTTTTTTGAATATGCAATCCC
 
. : . : . : . : . : . :
JMFF007P13+ AACTTTTTTTTTTGATAATACAATCCCAACTTTCTAATCACTCCATTGAAGACCAAACCT
rJMSF001N11- ATCCCAACTTTCTAATCACTCCATTGAAGACCAAACCT
                      ____________________________________________________________
consensus AACTTTTTTTTTTGATAATACAATCCCAACTTTCTAATCACTCCATTGAAGACCAAACCT
 
. : . : . : . : . : . :
JMFF007P13+ CGACACATATAATCATACTATGATACTAAA
rJMSF001N11- CGACACATATAATCATACTATGATACTAAACCCCAAAACTTGTTCCAAACAACCTAATTC
rJMSF037N09- TTC
                      ____________________________________________________________
consensus CGACACATATAATCATACTATGATACTAAACCCCAAAACTTGTTCCAAACAACCTAATTC
 
. : . : . : . : . : . :
rJMSF001N11- TTTTATACACACTTTGTTTTAGACCGACCAGTAAAATCGCAATCACAAACTATTTGGGAG
rJMSF037N09- TTTTATACNCNCTTTGTTTTANACCGACCAGTAAANTCNCANTCACAAACTATTTGGGAG
JMSF037N09+ TGGGAG
                      ____________________________________________________________
consensus TTTTATACACACTTTGTTTTAGACCGACCAGTAAAATCGCAATCACAAACTATTTGGGAG
 
. : . : . : . : . : . :
rJMSF001N11- TGNGCACGGGATATACNCGCTTGTTTTGATGCGATTAANGATGGATTTCATCATCTGATC
rJMSF037N09- NGTGCACGGGATATACACGCTNGTTTTGATGCGATTAANGATGGATTTCATCATCTGATC
JMSF037N09+ TGTGCACGGGATATACACGCTTGTTTTGATGCGATTAATGATGGATTTCATCATCTGATC
                      ____________________________________________________________
consensus TGTGCACGGGATATACACGCTTGTTTTGATGCGATTAATGATGGATTTCATCATCTGATC
 
. : . : . : . : . : . :
rJMSF001N11- TGATTATTCTGATCCTACTTGAAATGGATGGNGGGAGTTTACATAATANAGCANACGGAG
rJMSF037N09- TGATTATTCTGATCCTACTTGAAANGGATGGTGGGAGTTTACATAATAGAGCANACGGAG
JMSF037N09+ TGATTATTCTGATCCTACTTGAAATGGATGGTGGGAGTTTACATAATAGAGCAGACGGAG
                      ____________________________________________________________
consensus TGATTATTCTGATCCTACTTGAAATGGATGGTGGGAGTTTACATAATAGAGCAGACGGAG
 
. : . : . : . : . : . :
rJMSF001N11- GGTTGGTAATCATGAACTGGGCAAGCGTAGTAAGGGGGGTAAGGAAAGNGAGAAGGATCC
rJMSF037N09- GGTTGGTAATCATGAACTGGGCAAGCGTAGTAAGGGGGGTAAGGAAAGTGAGAAGGATCC
JMSF037N09+ GGTTGGTAATCATGAACTGGGCAAGCGTAGTAAGGGGGGTAAGGAAAGTGAGAAGGATCC
                      ____________________________________________________________
consensus GGTTGGTAATCATGAACTGGGCAAGCGTAGTAAGGGGGGTAAGGAAAGTGAGAAGGATCC
 
. : . : . : . : . : . :
rJMSF001N11- NGGAANACTGTAACGACTTTTGGNGGTTGGGCCTCGTCTTTCTTCTTATCCTCCTTCTTC
rJMSF037N09- NGGAANACTGTAACGACTTTTGGNGGTTGGGCCTCGTCTTTCTTCTTATCCTCCTTCTTC
JMSF037N09+ TGGAAGACTGTAACGACTTTTGGTGGTTGGGCCTCGTCTTTCTTCTTATCCTCCTTCTTC
                      ____________________________________________________________
consensus TGGAAGACTGTAACGACTTTTGGTGGTTGGGCCTCGTCTTTCTTCTTATCCTCCTTCTTC
 
. : . : . : . : . : . :
rJMSF001N11- NCCTCCTTTTTCTCTTCCTTTTTCTCGGCCGAACCCACGCTCACTAGCTCCGCTTGCCCC
rJMSF037N09- TCCTCCTTTTTCTCTTCCTTTTTCTCGGCCGAACCCACGCTCACTAGCTCCGCTTGCCCC
JMSF037N09+ TCCTCCTTTTTCTCTTCCTTTTTCTCGGCCGAACCCACGCTCACTAGCTCCGCTTGCCCC
                      ____________________________________________________________
consensus TCCTCCTTTTTCTCTTCCTTTTTCTCGGCCGAACCCACGCTCACTAGCTCCGCTTGCCCC
 
. : . : . : . : . : . :
rJMSF001N11- ACCCTCTTCCTCAGCAGGTTCGCCANAACCACCGAGTCGAACTCGCCCACCACCTCTAAC
rJMSF037N09- ACCCTCTTCCTCAGCAGGTTCGCCAGAACCACCGAGTCGAACTCGCCCACCACCTCTAAN
JMSF037N09+ ACCCTCTTCCTCAGCAGGTTCGCCAGAACCACCGAGTCGAACTCGCCCACCACCTCTAAC
                      ____________________________________________________________
consensus ACCCTCTTCCTCAGCAGGTTCGCCAGAACCACCGAGTCGAACTCGCCCACCACCTCTAAC
 
. : . : . : . : . : . :
rJMSF001N11- TGCCCCTTCTCCGCTTGCATAGCCGCCGATTCAACCCC
rJMSF037N09- NGCCCCTTCTCCGCTTGCATANCCGCCGATTCAACCCCTGCAGGAAACCACAAAACTTGC
JMSF037N09+ TGCCCCTTCTCCGCTTGCATAGCCGCCGATTCAACCCCTGCAGGAAACCACAAAACTTGC
                      ____________________________________________________________
consensus TGCCCCTTCTCCGCTTGCATAGCCGCCGATTCAACCCCTGCAGGAAACCACAAAACTTGC
 
. : . : . : . : . : . :
rJMSF037N09- CGGTAAAGACCAGTACTTGGNGAAAAATGTGATGACGGTCTATAAAGAAATAAAGTTATG
JMSF037N09+ CGGTAAAGACCAGTACTTGGTGAAAAATGTGATGACGGTCTATAAAGAAATAAAGTTATG
                      ____________________________________________________________
consensus CGGTAAAGACCAGTACTTGGTGAAAAATGTGATGACGGTCTATAAAGAAATAAAGTTATG
 
. : . : . : . : . : . :
rJMSF037N09- CGTACCAGGCAGGCTGACGGCAATCTTGAAGGCCTTGGTACGAGCCTTCTGGTCCTTGAT
JMSF037N09+ CGTACCAGGCAGGCTGACGGCAATCTTGAAGGCCTTGGTACGAGCCTTCTGGTCCTTGAT
                      ____________________________________________________________
consensus CGTACCAGGCAGGCTGACGGCAATCTTGAAGGCCTTGGTACGAGCCTTCTGGTCCTTGAT
 
. : . : . : . : . : . :
rJMSF037N09- TGA
JMSF037N09+ TGAGATACCGATCACTACCTTTTGCTTCCCCATTCTTTCTGCAGGCAGGGTAGAGAGATA
                      ____________________________________________________________
consensus TGAGATACCGATCACTACCTTTTGCTTCCCCATTCTTTCTGCAGGCAGGGTAGAGAGATA
 
. : . : . : . : . : . :
JMSF037N09+ AAGCGGCGAAGAATAGAGAATTTAGAGAGAGAAAGAAGTATGGATGGAGCTACTACTCTC
                      ____________________________________________________________
consensus AAGCGGCGAAGAATAGAGAATTTAGAGAGAGAAAGAAGTATGGATGGAGCTACTACTCTC