Previous Contig 007176:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF040M22Sequence348007176 (6)gb:AB124646_15280785e-27Nicotiana tabacum NtTPC1A mRNA for two-pore calcium channel, complete cds.672010089 (4)gb:AB124647_15280793e-56Nicotiana tabacum NtTPC1B mRNA for two-pore calcium channel, complete cds.
JMFS107E02Sequence627007176 (6)gb:AB124646_15280783e-56Nicotiana tabacum NtTPC1A mRNA for two-pore calcium channel, complete cds.
JMFS142G02Sequence626007176 (6)gb:AB124646_15280786e-52Nicotiana tabacum NtTPC1A mRNA for two-pore calcium channel, complete cds.
JMSF025C07Sequence684007176 (6)gb:AB124646_15280784e-51Nicotiana tabacum NtTPC1A mRNA for two-pore calcium channel, complete cds.764010089 (4)gb:AB124647_15280792e-74Nicotiana tabacum NtTPC1B mRNA for two-pore calcium channel, complete cds.
JMSF037N05Sequence615007176 (6)gb:AB124646_15280785e-52Nicotiana tabacum NtTPC1A mRNA for two-pore calcium channel, complete cds.670010089 (4)gb:AB124647_15280791e-59Nicotiana tabacum NtTPC1B mRNA for two-pore calcium channel, complete cds.
JMSF044A06Sequence746007176 (6)gb:AB124646_15280786e-74Nicotiana tabacum NtTPC1A mRNA for two-pore calcium channel, complete cds.747010089 (4)gb:AB124647_15280795e-80Nicotiana tabacum NtTPC1B mRNA for two-pore calcium channel, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF044A06+ AGCTACAG
                      ____________________________________________________________
consensus AGCTACAG
 
. : . : . : . : . : . :
JMSF044A06+ AACAGAAGAAATGAAACTGACAAAACCATGACATTAAGGTAGGTTCCAGACATTCCAGCA
                      ____________________________________________________________
consensus AACAGAAGAAATGAAACTGACAAAACCATGACATTAAGGTAGGTTCCAGACATTCCAGCA
 
. : . : . : . : . : . :
JMSF044A06+ AGGATCACGATGCTGTCTCTCAATTCCCTGATATTGAGAATGAAAAATACAACCCGTACA
JMFS107E02+ TACA
                      ____________________________________________________________
consensus AGGATCACGATGCTGTCTCTCAATTCCCTGATATTGAGAATGAAAAATACAACCCGTACA
 
. : . : . : . : . : . :
JMSF044A06+ TAGGGTGCAGCCCTGAATGGCAGATAATACAAGCCAGCTATGGAGAGAACATAGACCACC
JMFS107E02+ TAGGGTGCAGCCCTGAATGGCAGATAATACAAGCCAGCTATGGAGAGAACATAGACCACC
JMFS142G02+ AGCCAGCTATGGAGAGAACATAGACCACC
JMSF025C07+ AGCCAGCTATGGAGAGAACATAGACCACC
                      ____________________________________________________________
consensus TAGGGTGCAGCCCTGAATGGCAGATAATACAAGCCAGCTATGGAGAGAACATAGACCACC
 
. : . : . : . : . : . :
JMSF044A06+ AGATCTGCAACCAAAACTAACAGCAATAGGACCTTTAACCTATTGAGGATGCTTCTCCAG
JMFS107E02+ AGATCTGCAACCAAAACTAACAGCAATAGGACCTTTAACCTATTGAGGATGCTTCTCCAG
JMFS142G02+ AGATCTGCAACCAAAACTAACAGCAATAGGACCTTTAACCTATTGAGGATGCTTCTCCAG
JMSF025C07+ AGATCTGCAACCAAAACTAACAGCAATAGGACCTTTAACCTATTGAGGATGCTTCTCCAG
JMSF037N05+ AGGATGCTTCTCCAG
                      ____________________________________________________________
consensus AGATCTGCAACCAAAACTAACAGCAATAGGACCTTTAACCTATTGAGGATGCTTCTCCAG
 
. : . : . : . : . : . :
JMSF044A06+ TATATCTGAAAACCTTCATATGATATTGGAAATAAAGCATGTGTCACAAGAATTACAAGA
JMFS107E02+ TATATCTGAAAACCTTCATATGATATTGGAAATAAAGCATGTGTCACAAGAATTACAAGA
JMFS142G02+ TATATCTGAAAACCTTCATATGATATTGGAAATAAAGCATGTGTCACAAGAATTACAAGA
JMSF025C07+ TATATCTGAAAACCTTCATATGATATTGGAAATAAAGCATGTGTCACAAGAATTACAAGA
JMSF037N05+ TATATCTGAAAACCTTCATATGATATTGGAAATAAAGCATGTGTCACAAGAATTACAAGA
                      ____________________________________________________________
consensus TATATCTGAAAACCTTCATATGATATTGGAAATAAAGCATGTGTCACAAGAATTACAAGA
 
. : . : . : . : . : . :
JMSF044A06+ GTAACACCCTCATATACAAGAGACCCAGTGTTAGTCAAGTAAGGCAGCTGCCCAAGAAAG
JMFS107E02+ GTAACACCCTCATATACAAGAGACCCAGTGTTAGTCAAGTAAGGCAGCTGCCCAAGAAAG
JMFS142G02+ GTAACACCCTCATATACAAGAGACCCAGTGTTAGTCAAGTAAGGCAGCTGCCCAAGAAAG
JMSF025C07+ GTAACACCCTCATATACAAGAGACCCAGTGTTAGTCAAGTAAGGCAGCTGCCCAAGAAAG
JMSF037N05+ GTAACACCCTCATATACAAGAGACCCAGTGTTAGTCAAGTAAGGCAGCTGCCCAAGAAAG
                      ____________________________________________________________
consensus GTAACACCCTCATATACAAGAGACCCAGTGTTAGTCAAGTAAGGCAGCTGCCCAAGAAAG
 
. : . : . : . : . : . :
JMSF044A06+ TAGTACTGTCTGTCACTGCAGCCATAAGCAGACTGTTTGGAGCACCATAGTGGTTTCTCA
JMFS107E02+ TAGTACTGTCTGTCACTGCAGCCATAAGCAGACTGTTTGGAGCACCATAGTGGTTTCTCA
JMFF040M22+ CCATAGTGGTTTCTCA
JMFS142G02+ TAGTACTGTCTGTCACTGCAGCCATAAGCAGACTGTTTGGAGCACCATAGTGGTTTCTCA
JMSF025C07+ TAGTACTGTCTGTCACTGCAGCCATAAGCAGACTGTTTGGAGCACCATAGTGGTTTCTCA
JMSF037N05+ TAGTACTGTCTGTCACTGCAGCCATAAGCAGACTGTTTGGAGCACCATAGTGGTTTCTCA
                      ____________________________________________________________
consensus TAGTACTGTCTGTCACTGCAGCCATAAGCAGACTGTTTGGAGCACCATAGTGGTTTCTCA
 
. : . : . : . : . : . :
JMSF044A06+ AGAAAGTTCAGAACAATCAAAGCAAAATAGTTTAGGGACCATAGGAAATCAAATCGTGTA
JMFS107E02+ AGAAAGTTCAGAACAATCAAAGCAAAATAGTTTAGGGACCATAGGAAATCAAATCGTGTA
JMFF040M22+ AGAAAGTTCAGAACAATCAAAGCAAAATAGTTTAGGGACCATAGGAAATCAAATCGTGTA
JMFS142G02+ AGAAAGTTCAGAACAATCAAAGCAAAATAGTTTAGGGACCATAGGAAATCAAATCGTGTA
JMSF025C07+ AGAAAGTTCAGAACAATCAAAGCAAAATAGTTTAGGGACCATAGGAAATCAAATCGTGTA
JMSF037N05+ AGAAAGTTCAGAACAATCAAAGCAAAATAGTTTAGGGACCATAGGAAATCAAATCGTGTA
                      ____________________________________________________________
consensus AGAAAGTTCAGAACAATCAAAGCAAAATAGTTTAGGGACCATAGGAAATCAAATCGTGTA
 
. : . : . : . : . : . :
JMSF044A06+ AATATGAAGTATAACTTTGCTGCACTTGCAAAGCTTGATTGATCAAGGATTTCCTCAGGT
JMFS107E02+ AATATGAAGTATAACTTTGCTGCACTTGCAAAGCTTGATTGATCAAGGATTTCCTCAGGT
JMFF040M22+ AATATGAAGTATAACTTTGCTGCACTTGCAAAGCTTGATTGATCAAGGATTTCCTCAGGT
JMFS142G02+ AATATGAAGTATAACTTTGCTGCACTTGCAAAGCTTGATTGATCAAGGATTTCCTCAGGT
JMSF025C07+ AATATGAAGTATAACTTTGCTGCACTTGCAACGCTTGATTGATCAAGGATTTCCTCAGGT
JMSF037N05+ AATATGAAGTATAACTTTGCTGCACTTGCAAAGCTTGATTGATCAAGGATTTCCTCAGGT
                      ____________________________________________________________
consensus AATATGAAGTATAACTTTGCTGCACTTGCAAAGCTTGATTGATCAAGGATTTCCTCAGGT
 
. : . : . : . : . : . :
JMSF044A06+ ATCCCAACACCATCTTCAGCAAGATCAACCAAAGCAGCGGCCTTCTGGTAAGTGGATCCG
JMFS107E02+ ATCCCAACACCATCTTCAGCAAGATCAACCAAAGCAGCGGCCTTCTGGTAAGTGGATCCG
JMFF040M22+ ATCCCAACACCATCTTCAGCAAGATCAACCAAAGCAGCGGCCTTCTGGTAAGTGGATCCG
JMFS142G02+ ATCCCAACACCATCTTCAGCAAGATCAACCAAAGCAGCGGCCTTCTGGTAAGTGGATCCG
JMSF025C07+ ATCCCAACACCATCTTCAGCAAGATCAACCAAAGCAGCGGCCTTCTGGTAAGTGGATCCG
JMSF037N05+ ATCCCAACACCATCTTCAGCAAGATCAACCAAAGCAGCGGCCTTCTGGTAAGTGGATCCG
                      ____________________________________________________________
consensus ATCCCAACACCATCTTCAGCAAGATCAACCAAAGCAGCGGCCTTCTGGTAAGTGGATCCG
 
. : . : . : . : . : . :
JMSF044A06+ TACACAATTGCATCTGATCGGCTACTGAAAGCGCGTCGCCGGAAGAGCCGGAGGGGACCG
JMFS107E02+ TACACAATTGCATCTGATCGGCTACTGAAAGCGCGTCGCCGGAAGAGCCGGAGGGGACCG
JMFF040M22+ TACACAATTGCATCTGATCGGCTACTGAAAGCGCGTCGCCGGAAGAGCCGGAGGGGACCG
JMFS142G02+ TACACAATTGCATCTGATCGGCTACTGAAAGCGCGTCGCCGGAAGAGCCGGAGGGGACCG
JMSF025C07+ TACACAATTGCATCTGATCGGCTACTGAAAGCGCGTCGCCGGAAGAGCCGGAGGGGACCG
JMSF037N05+ TACACAATTGCATCTGATCGGCTACTGAAAGCGCGTCGCCGGAAGAGCCGGAGGGGACCG
                      ____________________________________________________________
consensus TACACAATTGCATCTGATCGGCTACTGAAAGCGCGTCGCCGGAAGAGCCGGAGGGGACCG
 
. : . : . : . : . : . :
JMSF044A06+ GAACCACCACCACTTCCGCTGCTCTCTCCACTCAGTAGAGCAGTCTCCATCTTGGCTTAT
JMFS107E02+ GAACCACCACCACTTCCGCTGCTCTCTCCACTCAGTAGAGCAGTCTCCATCTTGGCTTAT
JMFF040M22+ GAACCACCACCACTTCCGCTGCTCTCTCCACTCAGTAGAGCAGTCTCCATCTTGGCTTAT
JMFS142G02+ GAACCACCACCACTTCCGCTGCTCTCTCCACTCAGTAGAGCAGTCTCCATCTTGGCTTAT
JMSF025C07+ GAACCACCACCACTTCCGCTGCTCTCTCCACTCAGTAGAGCAGTCTCCATCTTGGCTTAT
JMSF037N05+ GAACCACCACCACTTCCGCTGCTCTCTCCACTCAGTAGAGCAGTCTCCATCTTGGCTTAT
                      ____________________________________________________________
consensus GAACCACCACCACTTCCGCTGCTCTCTCCACTCAGTAGAGCAGTCTCCATCTTGGCTTAT
 
. : . : . : . : . : . :
JMSF044A06+ CTGTAACTATTGCTTC
JMFS107E02+ CTGTAACTATTGCTTCTGGATCA
JMFF040M22+ CTGTAACTATTGCTTCTGGATCAGGTACGT
JMFS142G02+ CTGTAACTATTGCTTCTGGATCAGGTACGTACCAATGCCGACACTAACAAAA
JMSF025C07+ CTGTAACTATTGCTTCTGGATCAGGTACGTACCAATGCCGACACTAACAAAATCACAATG
JMSF037N05+ CTGTAACTATTGCTTCTGGATCAGGTACGTACCAATGCCGACACTAACAAAATCACAATG
                      ____________________________________________________________
consensus CTGTAACTATTGCTTCTGGATCAGGTACGTACCAATGCCGACACTAACAAAATCACAATG
 
. : . : . : . : . : . :
JMSF025C07+ TAGCGGAAAACCAGAAGACGAACTGTGTTGTGTGCGCACTACTTTTGAATGCAT
JMSF037N05+ TAGCGGAAAACCAGAAGACGAACTGTGTTGTGTGCGCACTACTTTTGAATGCATACATCC
                      ____________________________________________________________
consensus TAGCGGAAAACCAGAAGACGAACTGTGTTGTGTGCGCACTACTTTTGAATGCATACATCC