Previous Contig 007168:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF007G20Sequence517007168 (28)pir|T48278|T482787e-43hypothetical protein T22P11.160 - Arabidopsis thaliana>gb:ATT22P11_1555330 Arabi661007168 (28)pir|T48278|T482781e-43hypothetical protein T22P11.160 - Arabidopsis thaliana>gb:ATT22P11_1555330 Arabi
JMFF008K09Sequence526007168 (28)pir|T48278|T482788e-44hypothetical protein T22P11.160 - Arabidopsis thaliana>gb:ATT22P11_1555330 Arabi663007168 (28)pir|T48278|T482781e-43hypothetical protein T22P11.160 - Arabidopsis thaliana>gb:ATT22P11_1555330 Arabi
JMFF022N07Sequence431007168 (28)pir|T48278|T482788e-27hypothetical protein T22P11.160 - Arabidopsis thaliana>gb:ATT22P11_1555330 Arabi662007168 (28)pir|T48278|T482781e-43hypothetical protein T22P11.160 - Arabidopsis thaliana>gb:ATT22P11_1555330 Arabi
JMFF033G19Sequence528007168 (28)pir|T48278|T482789e-44hypothetical protein T22P11.160 - Arabidopsis thaliana>gb:ATT22P11_1555330 Arabi665007168 (28)pir|T48278|T482781e-43hypothetical protein T22P11.160 - Arabidopsis thaliana>gb:ATT22P11_1555330 Arabi
JMFF036H08Sequence526007168 (28)pir|T48278|T482788e-44hypothetical protein T22P11.160 - Arabidopsis thaliana>gb:ATT22P11_1555330 Arabi653007168 (28)pir|T48278|T482781e-43hypothetical protein T22P11.160 - Arabidopsis thaliana>gb:ATT22P11_1555330 Arabi
JMFN010I24Sequence640007168 (28)pir|T48278|T482781e-43hypothetical protein T22P11.160 - Arabidopsis thaliana>gb:ATT22P11_1555330 Arabi
JMSF010I22Sequence255005474 (26)648007168 (28)pir|T48278|T482781e-43hypothetical protein T22P11.160 - Arabidopsis thaliana>gb:ATT22P11_1555330 Arabi
JMSF017I24Sequence374007168 (28)pir|D84688|D846882e-16probable histone H2B [imported] - Arabidopsis thaliana>gb:AC007184_1535489 Arabi654007168 (28)pir|T48278|T482781e-43hypothetical protein T22P11.160 - Arabidopsis thaliana>gb:ATT22P11_1555330 Arabi
JMSF019K02Sequence475005474 (26)gb:AY269087_15940275e-07Lycopersicon esculentum GAI-like protein mRNA, complete cds.622007168 (28)pir|T48278|T482781e-43hypothetical protein T22P11.160 - Arabidopsis thaliana>gb:ATT22P11_1555330 Arabi
JMSF019L08Sequence651007168 (28)pir|T48278|T482781e-43hypothetical protein T22P11.160 - Arabidopsis thaliana>gb:ATT22P11_1555330 Arabi
JMSF019M08Sequence487007168 (28)pir|T48278|T482781e-37hypothetical protein T22P11.160 - Arabidopsis thaliana>gb:ATT22P11_1555330 Arabi653007168 (28)pir|T48278|T482781e-43hypothetical protein T22P11.160 - Arabidopsis thaliana>gb:ATT22P11_1555330 Arabi
JMSF022N03Sequence677007168 (28)pir|T48278|T482782e-43hypothetical protein T22P11.160 - Arabidopsis thaliana>gb:ATT22P11_1555330 Arabi651007168 (28)pir|T48278|T482781e-43hypothetical protein T22P11.160 - Arabidopsis thaliana>gb:ATT22P11_1555330 Arabi
JMSF037L11Sequence627007168 (28)pir|T48278|T482781e-43hypothetical protein T22P11.160 - Arabidopsis thaliana>gb:ATT22P11_1555330 Arabi570007168 (28)pir|T48278|T482781e-43hypothetical protein T22P11.160 - Arabidopsis thaliana>gb:ATT22P11_1555330 Arabi
JMSF041P02Sequence693007168 (28)pir|T48278|T482782e-43hypothetical protein T22P11.160 - Arabidopsis thaliana>gb:ATT22P11_1555330 Arabi640007168 (28)pir|T48278|T482781e-43hypothetical protein T22P11.160 - Arabidopsis thaliana>gb:ATT22P11_1555330 Arabi
JMSF046P16Sequence696007168 (28)pir|T48278|T482782e-43hypothetical protein T22P11.160 - Arabidopsis thaliana>gb:ATT22P11_1555330 Arabi588007168 (28)pir|T48278|T482781e-43hypothetical protein T22P11.160 - Arabidopsis thaliana>gb:ATT22P11_1555330 Arabi
JMSF047H07Sequence685007168 (28)pir|T48278|T482782e-43hypothetical protein T22P11.160 - Arabidopsis thaliana>gb:ATT22P11_1555330 Arabi179007168 (28)

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF022N07+ ACCACGCTGTTTGCCTCTCATCTCACTCAACCTAA
JMFN010I24- CTCATCTCACTCAACCTAA
rJMFF007G20+ ACCACGCTGTTTGCCTCTCATCTCACTCAACCTAA
rJMFF033G19+ CACGCTGTTTGCCTCTCATCTCACTCAACCTAA
rJMFF008K09+ GCTGTTTGCCTCTCATCTCACTCAACCTAA
rJMFF036H08+ TTTGCCTCTCATCTCACTCAACCTAA
rJMSF019M08+ ACGCTGTTTGCCTCTCATCTCACTCAACCTAA
rJMSF019L08+ ACGCTGTTTGCCTCTCATCTCACTCAACCTAA
rJMSF010I22+ CGCTGTTTGCCTCTCATCTCACTCAACCTAA
rJMSF017I24+ CACGCTGTTTGCCTCTCATCTCACTCAACCTAA
rJMSF022N03+ GACCACGCTGTTTGCCTCTCATCTCACTCAACCTAA
rJMSF019K02+ TTGCCTCTCATCTCACTCAACCTAA
JMFF033G19- ACCACGCTGTTTGCCTCTCATCTCACTCAACCTAA
JMFF008K09- ACCACGCTGTTTGCCTCTCATCTCACTCAACCTAA
JMFF007G20- ACCACGCTGTTTGCCTCTCATCTCACTCAACCTAA
JMSF019M08- ACGCTGTTTGCCTCTCATCTCACTCAACCTAA
JMFF022N07- ACCACGCTGTTTGCCTCTCATCTCACTCAACCTAA
JMSF017I24- CACGCTGTTTGCCTCTCATCTCACTCAACCTAA
JMSF022N03- GACCACGCTGTTTGCCTCTCATCTCACTCAACCTAA
JMSF047H07- GACCACGCTGTTTGCCTCTCATCTCACTCAACCTAA
JMFF036H08- CGCTGTTTGCCTCTCATCTCACTCAACCTAA
JMSF046P16- GACCACGCTGTTTGCCTCTCATCTCACTCAACCTAA
rJMSF041P02+ CGCTGTTTGCCTCTCATCTCACTCAACCTAA
JMSF041P02- CGCTGTTTGCCTCTCATCTCACTCAACCTAA
                      ____________________________________________________________
consensus GACCACGCTGTTTGCCTCTCATCTCACTCAACCTAA
 
. : . : . : . : . : . :
rJMFF022N07+ CTTTTATCTCTTTGTTGTAAACACCGTTTCTGTTTCTCTAGATTCAATGGCCCCAAAGGC
rJMSF046P16+ TCTGTTTCTCTAGATTCAATGGCCCCAAAGGC
JMFN010I24- CTTTTATCTCTTTGTTGTAAACACCGTTTCTGTTTCTCTAGATTCAATGGCCCCAAAGGC
rJMFF007G20+ CTTTTATCTCTTTGTTGTAAACACCGTTTCTGTTTCTCTAGATTCAATGGCCCCAAAGGC
rJMFF033G19+ CTTTTATCTCTTTGTTGTAAACACCGTTTCTGTTTCTCTAGATTCAATGGCCCCAAAGGC
rJMFF008K09+ CTTTTATCTCTTTGTTGTAAACACCGTTTCTGTTTCTCTAGATTCAATGGCCCCAAAGGC
rJMFF036H08+ CTTTTATCTCTTTGTTGTAAACACCGTTTCTGTTTCTCTAGATTCAATGGCCCCAAAGGC
rJMSF019M08+ CTTTTATCTCTTTGTTGTAAACACCGTTTCTGTTTCTCTAGATTCAATGGCCCCAAAGGC
rJMSF019L08+ CTTTTATCTCTTTGTTGTAAACACCGTTTCTGTTTCTCTAGATTCAATGGCCCCAAAGGC
rJMSF010I22+ CTTTTATCTCTTTGTTGTAAACACCGTTTCTGTTTCTCTAGATTCAATGGCCCCAAAGGC
rJMSF017I24+ CTTTTATCTCTTTGTTGTAAACACCGTTTCTGTTTCTCTAGATTCAATGGCCCCAAAGGC
rJMSF022N03+ CTTTTATCTCTTTGTTGTAAACACCGTTTCTGTTTCTCTAGATTCAATGGCCCCAAAGGC
rJMSF019K02+ CTTTTATCTCTTTGTTGTAAACACCGTTTCTGTTTCTCTAGATTCAATGGCCCCAAAGGC
JMFF033G19- CTTTTATCTCTTTGTTGTAAACACCGTTTCTGTTTCTCTAGATTCAATGGCCCCAAAGGC
JMFF008K09- CTTTTATCTCTTTGTTGTAAACACCGTTTCTGTTTCTCTAGATTCAATGGCCCCAAAGGC
rJMSF047H07+ TGGCCCCAAANGC
JMFF007G20- CTTTTATCTCTTTGTTGTAAACACCGTTTCTGTTTCTCTAGATTCAATGGCCCCAAAGGC
JMSF019M08- CTTTTATCTCTTTGTTGTAAACACCGTTTCTGTTTCTCTAGATTCAATGGCCCCAAAGGC
JMFF022N07- CTTTTATCTCTTTGTTGTAAACACCGTTTCTGTTTCTCTAGATTCAATGGCCCCAAAGGC
JMSF017I24- CTTTTATCTCTTTGTTGTAAACACCGTTTCTGTTTCTCTAGATTCAATGGCCCCAAAGGC
JMSF022N03- CTTTTATCTCTTTGTTGTAAACACCGTTTCTGTTTCTCTAGATTCAATGGCCCCAAAGGC
JMSF047H07- CTTTTATCTCTTTGTTGTAAACACCGTTTCTGTTTCTCTAGATTCAATGGCCCCAAAGGC
JMFF036H08- CTTTTATCTCTTTGTTGTAAACACCGTTTCTGTTTCTCTAGATTCAATGGCCCCAAAGGC
JMSF046P16- CTTTTATCTCTTTGTTGTAAACACCGTTTCTGTTTCTCTAGATTCAATGGCCCCAAAGGC
rJMSF041P02+ CTTTTATCTCTTTGTTGTAAACACCGTTTCTGTTTCTCTAGATTCAATGGCCCCAAAGGC
JMSF041P02- CTTTTATCTCTTTGTTGTAAACACCGTTTCTGTTTCTCTAGATTCAATGGCCCCAAAGGC
                      ____________________________________________________________
consensus CTTTTATCTCTTTGTTGTAAACACCGTTTCTGTTTCTCTAGATTCAATGGCCCCAAAGGC
 
. : . : . : . : . : . :
rJMFF022N07+ AGAGAAGAAACCAGCTGAGAAGAAGCCGGCGGCAGAGAAGGCCCCAGCCGCCGAGAAGGC
rJMSF046P16+ AGAGAAGAAACCAGCTGAGAAGAAGCCGGCGGCAGAGAAGGCCCCAGCCGCCGAGAAGGC
JMFN010I24- AGAGAAGAAACCAGCTGAGAAGAAGCCGGCGGCAGAGAAGGCCCCAGCCGCCGAGAAGGC
rJMFF007G20+ AGAGAAGAAACCAGCTGAGAAGAAGCCGGCGGCAGAGAAGGCCCCAGCCGCCGAGAAGGC
rJMFF033G19+ AGAGAAGAAACCAGCTGAGAAGAAGCCGGCGGCAGAGAAGGCCCCAGCCGCCGAGAAGGC
rJMFF008K09+ AGAGAAGAAACCAGCTGAGAAGAAGCCGGCGGCAGAGAAGGCCCCAGCCGCCGAGAAGGC
rJMFF036H08+ AGAGAAGAAACCAGCTGAGAAGAAGCCGGCGGCAGAGAAGGCCCCAGCCGCCGAGAAGGC
rJMSF019M08+ AGAGAAGAAACCAGCTGAGAAGAAGCCGGCGGCAGAGAAGGCCCCAGCCGCCGAGAAGGC
rJMSF019L08+ AGAGAAGAAACCAGCTGAGAAGAAGCCGGCGGCAGAGAAGGCCCCAGCCGCCGAGAAGGC
rJMSF010I22+ AGAGAAGAAACCAGCTGAGAAGAAGCCGGCGGCAGAGAAGGCCCCAGCCGCCGAGAAGGC
rJMSF017I24+ AGAGAAGAAACCAGCTGAGAAGAAGCCGGCGGCAGAGAAGGCCCCAGCCGCCGAGAAGGC
rJMSF022N03+ AGAGAAGAAACCAGCTGAGAAGAAGCCGGCGGCAGAGAAGGCCCCAGCCGCCGAGAAGGC
rJMSF019K02+ AGAGAAGAAACCAGCTGAGAAGAAGCCGGCGGCAGAGAAGGCCCCAGCCGCCGAGAAGGC
JMFF033G19- AGAGAAGAAACCAGCTGAGAAGAAGCCGGCGGCAGAGAAGGCCCCAGCCGCCGAGAAGGC
JMFF008K09- AGAGAAGAAACCAGCTGAGAAGAAGCCGGCGGCAGAGAAGGCCCCAGCCGCCGAGAAGGC
rJMSF047H07+ AGAGAAGAAACCANCTGAGAAGAAGCCGGCGGCAGAGAAGGCNCCAGNCGCCGAGAAGNC
JMFF007G20- AGAGAAGAAACCAGCTGAGAAGAAGCCGGCGGCAGAGAAGGCCCCAGCCGCCGAGAAGGC
JMSF019M08- AGAGAAGAAACCAGCTGAGAAGAAGCCGGCGGCAGAGAAGGCCCCAGCCGCCGAGAAGGC
JMFF022N07- AGAGAAGAAACCAGCTGAGAAGAAGCCGGCGGCAGAGAAGGCCCCAGCCGCCGAGAAGGC
JMSF017I24- AGAGAAGAAACCAGCTGAGAAGAAGCCGGCGGCAGAGAAGGCCCCAGCCGCCGAGAAGGC
JMSF022N03- AGAGAAGAAACCAGCTGAGAAGAAGCCGGCGGCAGAGAAGGCCCCAGCCGCCGAGAAGGC
JMSF047H07- AGAGAAGAAACCAGCTGAGAAGAAGCCGGCGGCAGAGAAGGCCCCAGCCGCCGAGAAGGC
JMFF036H08- AGAGAAGAAACCAGCTGAGAAGAAGCCGGCGGCAGAGAAGGCCCCAGCCGCCGAGAAGGC
JMSF046P16- AGAGAAGAAACCAGCTGAGAAGAAGCCGGCGGCAGAGAAGGCCCCAGCCGCCGAGAAGGC
rJMSF041P02+ AGAGAAGAAACCAGCTGAGAAGAAGCCGGCGGCAGAGAAGGCCCCAGCCGCCGAGAAGGC
JMSF041P02- AGAGAAGAAACCAGCTGAGAAGAAGCCGGCGGCAGAGAAGGCCCCAGCCGCCGAGAAGGC
                      ____________________________________________________________
consensus AGAGAAGAAACCAGCTGAGAAGAAGCCGGCGGCAGAGAAGGCCCCAGCCGCCGAGAAGGC
 
. : . : . : . : . : . :
rJMFF022N07+ TCCGGCGGAGAAGAAGCCGAAGGCGGGGAAGAAGCTCCCGAAGGACGGCGGAGCCGCGGC
rJMSF046P16+ TCCGGCGGAGAAGAAGCCGAAGGCGGGGAAGAAGCTCCCGAAGGACGGCGGAGCCGCGGC
rJMSF037L11+ GAAGAAGCTCCCGAAGGACGGCGGAGCCGCGGC
JMFN010I24- TCCGGCGGAGAAGAAGCCGAAGGCGGGGAAGAAGCTCCCGAAGGACGGCGGAGCCGCGGC
rJMFF007G20+ TCCGGCGGAGAAGAAGCCGAAGGCGGGGAAGAAGCTCCCGAAGGACGGCGGAGCCGCGGC
rJMFF033G19+ TCCGGCGGAGAAGAAGCCGAAGGCGGGGAAGAAGCTCCCGAAGGACGGCGGAGCCGCGGC
rJMFF008K09+ TCCGGCGGAGAAGAAGCCGAAGGCGGGGAAGAAGCTCCCGAAGGACGGCGGAGCCGCGGC
rJMFF036H08+ TCCGGCGGAGAAGAAGCCGAAGGCGGGGAAGAAGCTCCCGAAGGACGGCGGAGCCGCGGC
rJMSF019M08+ TCCGGCGGAGAAGAAGCCGAAGGCGGGGAAGAAGCTCCCGAAGGACGGCGGAGCCGCGGC
rJMSF019L08+ TCCGGCGGAGAAGAAGCCGAAGGCGGGGAAGAAGCTCCCGAAGGACGGCGGAGCCGCGGC
rJMSF010I22+ TCCGGCGGAGAAGAAGCCGAAGGCGGGGAAGAAGCTCCCGAAGGACGGCGGAGCCGCGGC
rJMSF017I24+ TCCGGCGGAGAAGAAGCCGAAGGCGGGGAAGAAGCTCCCGAAGGACGGCGGAGCCGCGGC
rJMSF022N03+ TCCGGCGGAGAAGAAGCCGAAGGCGGGGAAGAAGCTCCCGAAGGACGGCGGAGCCGCGGC
rJMSF019K02+ TCCGGCGGAGAAGAAGCCGAAGGCGGGGAAGAAGCTCCCGAAGGACGGCGGAGCCGCGGC
JMFF033G19- TCCGGCGGAGAAGAAGCCGAAGGCGGGGAAGAAGCTCCCGAAGGACGGCGGAGCCGCGGC
JMFF008K09- TCCGGCGGAGAAGAAGCCGAAGGCGGGGAAGAAGCTCCCGAAGGACGGCGGAGCCGCGGC
rJMSF047H07+ TCCGGCGGAGAAGAANCCGAAGNCGGGGAAGAAGCTCCNGAAGGACGGCGGAGCCNCGNC
JMFF007G20- TCCGGCGGAGAAGAAGCCGAAGGCGGGGAAGAAGCTCCCGAAGGACGGCGGAGCCGCGGC
JMSF019M08- TCCGGCGGAGAAGAAGCCGAAGGCGGGGAAGAAGCTCCCGAAGGACGGCGGAGCCGCGGC
JMFF022N07- TCCGGCGGAGAAGAAGCCGAAGGCGGGGAAGAAGCTCCCGAAGGACGGCGGAGCCGCGGC
JMSF017I24- TCCGGCGGAGAAGAAGCCGAAGGCGGGGAAGAAGCTCCCGAAGGACGGCGGAGCCGCGGC
JMSF022N03- TCCGGCGGAGAAGAAGCCGAAGGCGGGGAAGAAGCTCCCGAAGGACGGCGGAGCCGCGGC
JMSF047H07- TCCGGCGGAGAAGAAGCCGAAGGCGGGGAAGAAGCTCCCGAAGGACGGCGGAGCCGCGGC
JMFF036H08- TCCGGCGGAGAAGAAGCCGAAGGCGGGGAAGAAGCTCCCGAAGGACGGCGGAGCCGCGGC
JMSF046P16- TCCGGCGGAGAAGAAGCCGAAGGCGGGGAAGAAGCTCCCGAAGGACGGCGGAGCCGCGGC
rJMSF041P02+ TCCGGCGGAGAAGAAGCCGAAGGCGGGGAAGAAGCTCCCGAAGGACGGCGGAGCCGCGGC
JMSF041P02- TCCGGCGGAGAAGAAGCCGAAGGCGGGGAAGAAGCTCCCGAAGGACGGCGGAGCCGCGGC
JMSF037L11- GAAGAAGCTCCCGAAGGACGGCGGAGCCGCGGC
                      ____________________________________________________________
consensus TCCGGCGGAGAAGAAGCCGAAGGCGGGGAAGAAGCTCCCGAAGGACGGCGGAGCCGCGGC
 
. : . : . : . : . : . :
rJMFF022N07+ GGGAGAGAAGAAGAAGAAGAGGGTGAAGAAGTCGACGGAGACCTACAAGATTTACATCTT
rJMSF046P16+ GGGAGAGAAGAAGAAGAAGAGGGTGAAGAAGTCGACGGAGACCTACAAGATTTACATCTT
rJMSF037L11+ GGGAGAGAAGAAGAAGAAGAGGGTGAAGAAGTCGACGGAGACCTACAAGATTTACATCTT
JMFN010I24- GGGAGAGAAGAAGAAGAAGAGGGTGAAGAAGTCGACGGAGACCTACAAGATTTACATCTT
rJMFF007G20+ GGGAGAGAAGAAGAAGAAGAGGGTGAAGAAGTCGACGGAGACCTACAAGATTTACATCTT
rJMFF033G19+ GGGAGAGAAGAAGAAGAAGAGGGTGAAGAAGTCGACGGAGACCTACAAGATTTACATCTT
rJMFF008K09+ GGGAGAGAAGAAGAAGAAGAGGGTGAAGAAGTCGACGGAGACCTACAAGATTTACATCTT
rJMFF036H08+ GGGAGAGAAGAAGAAGAAGAGGGTGAAGAAGTCGACGGAGACCTACAAGATTTACATCTT
rJMSF019M08+ GGGAGAGAAGAAGAAGAAGAGGGTGAAGAAGTCGACGGAGACCTACAAGATTTACATCTT
rJMSF019L08+ GGGAGAGAAGAAGAAGAAGAGGGTGAAGAAGTCGACGGAGACCTACAAGATTTACATCTT
rJMSF010I22+ GGGAGAGAAGAAGAAGAAGAGGGTGAAGAAGTCGACGGAGACCTACAAGATTTACATCTT
rJMSF017I24+ GGGAGAGAAGAAGAAGAAGAGGGTGAAGAAGTCGACGGAGACCTACAAGATTTACATCTT
rJMSF022N03+ GGGAGAGAAGAAGAAGAAGAGGGTGAAGAAGTCGACGGAGACCTACAAGATTTACATCTT
rJMSF019K02+ GGGAGAGAAGAAGAAGAAGAGGGTGAAGAAGTCGACGGAGACCTACAAGATTTACATCTT
JMFF033G19- GGGAGAGAAGAAGAAGAAGAGGGTGAAGAAGTCGACGGAGACCTACAAGATTTACATCTT
JMFF008K09- GGGAGAGAAGAAGAAGAAGAGGGTGAAGAAGTCGACGGAGACCTACAAGATTTACATCTT
rJMSF047H07+ GGGAGAGAAGAAGAAGAAGAGGGTGAAGAAGTCGACGGAGACC
JMFF007G20- GGGAGAGAAGAAGAAGAAGAGGGTGAAGAAGTCGACGGAGACCTACAAGATTTACATCTT
JMSF019M08- GGGAGAGAAGAAGAAGAAGAGGGTGAAGAAGTCGACGGAGACCTACAAGATTTACATCTT
JMFF022N07- GGGAGAGAAGAAGAAGAAGAGGGTGAAGAAGTCGACGGAGACCTACAAGATTTACATCTT
JMSF017I24- GGGAGAGAAGAAGAAGAAGAGGGTGAAGAAGTCGACGGAGACCTACAAGATTTACATCTT
JMSF022N03- GGGAGAGAAGAAGAAGAAGAGGGTGAAGAAGTCGACGGAGACCTACAAGATTTACATCTT
JMSF047H07- GGGAGAGAAGAAGAAGAAGAGGGTGAAGAAGTCGACGGAGACCTACAAGATTTACATCTT
JMFF036H08- GGGAGAGAAGAAGAAGAAGAGGGTGAAGAAGTCGACGGAGACCTACAAGATTTACATCTT
JMSF046P16- GGGAGAGAAGAAGAAGAAGAGGGTGAAGAAGTCGACGGAGACCTACAAGATTTACATCTT
rJMSF041P02+ GGGAGAGAAGAAGAAGAAGAGGGTGAAGAAGTCGACGGAGACCTACAAGATTTACATCTT
JMSF041P02- GGGAGAGAAGAAGAAGAAGAGGGTGAAGAAGTCGACGGAGACCTACAAGATTTACATCTT
JMSF037L11- GGGAGAGAAGAAGAAGAAGAGGGTGAAGAAGTCGACGGAGACCTACAAGATTTACATCTT
                      ____________________________________________________________
consensus GGGAGAGAAGAAGAAGAAGAGGGTGAAGAAGTCGACGGAGACCTACAAGATTTACATCTT
 
. : . : . : . : . : . :
rJMFF022N07+ CAAGGTGCTGAAGCAGGTGCATCCCGACATCGGAATCTCTAGCAAGGCCATGGGAATCAT
rJMSF046P16+ CAAGGTGCTGAAGCAGGTGCATCCCGACATCGGAATCTCTAGCAAGGCCATGGGAATCAT
rJMSF037L11+ CAAGGTGCTGAAGCAGGTGCATCCCGACATCGGAATCTCTAGCAAGGCCATGGGAATCAT
JMFN010I24- CAAGGTGCTGAAGCAGGTGCATCCCGACATCGGAATCTCTAGCAAGGCCATGGGAATCAT
rJMFF007G20+ CAAGGTGCTGAAGCAGGTGCATCCCGACATCGGAATCTCTAGCAAGGCCATGGGAATCAT
rJMFF033G19+ CAAGGTGCTGAAGCAGGTGCATCCCGACATCGGAATCTCTAGCAAGGCCATGGGAATCAT
rJMFF008K09+ CAAGGTGCTGAAGCAGGTGCATCCCGACATCGGAATCTCTAGCAAGGCCATGGGAATCAT
rJMFF036H08+ CAAGGTGCTGAAGCAGGTGCATCCCGACATCGGAATCTCTAGCAAGGCCATGGGAATCAT
rJMSF019M08+ CAAGGTGCTGAAGCAGGTGCATCCCGACATCGGAATCTCTAGCAAGGCCATGGGAATCAT
rJMSF019L08+ CAAGGTGCTGAAGCAGGTGCATCCCGACATCGGAATCTCTAGCAAGGCCATGGGAATCAT
rJMSF010I22+ CAAGGTGCTGAAGCAGGTGCATCCCGACATCGGAATCTCTAGCAAGGCCATGGGAATCAT
rJMSF017I24+ CAAGGTGCTGAAGCAGGTGCATCCCGACATCGGAATCTCTAGCAAGGCCATGGGAATCAT
rJMSF022N03+ CAAGGTGCTGAAGCAGGTGCATCCCGACATCGGAATCTCTAGCAAGGCCATGGGAATCAT
rJMSF019K02+ CAAGGTGCTGAAGCAGGTGCATCCCGACATCGGAATCTCTAGCAAGGCCATGGGAATCAT
JMFF033G19- CAAGGTGCTGAAGCAGGTGCATCCCGACATCGGAATCTCTAGCAAGGCCATGGGAATCAT
JMFF008K09- CAAGGTGCTGAAGCAGGTGCATCCCGACATCGGAATCTCTAGCAAGGCCATGGGAATCAT
JMFF007G20- CAAGGTGCTGAAGCAGGTGCATCCCGACATCGGAATCTCTAGCAAGGCCATGGGAATCAT
JMSF019M08- CAAGGTGCTGAAGCAGGTGCATCCCGACATCGGAATCTCTAGCAAGGCCATGGGAATCAT
JMFF022N07- CAAGGTGCTGAAGCAGGTGCATCCCGACATCGGAATCTCTAGCAAGGCCATGGGAATCAT
JMSF017I24- CAAGGTGCTGAAGCAGGTGCATCCCGACATCGGAATCTCTAGCAAGGCCATGGGAATCAT
JMSF022N03- CAAGGTGCTGAAGCAGGTGCATCCCGACATCGGAATCTCTAGCAAGGCCATGGGAATCAT
JMSF047H07- CAAGGTGCTGAAGCAGGTGCATCCCGACATCGGAATCTCTAGCAAGGCCATGGGAATCAT
JMFF036H08- CAAGGTGCTGAAGCAGGTGCATCCCGACATCGGAATCTCTAGCAAGGCCATGGGAATCAT
JMSF046P16- CAAGGTGCTGAAGCAGGTGCATCCCGACATCGGAATCTCTAGCAAGGCCATGGGAATCAT
rJMSF041P02+ CAAGGTGCTGAAGCAGGTGCATCCCGACATCGGAATCTCTAGCAAGGCCATGGGAATCAT
JMSF041P02- CAAGGTGCTGAAGCAGGTGCATCCCGACATCGGAATCTCTAGCAAGGCCATGGGAATCAT
JMSF037L11- CAAGGTGCTGAAGCAGGTGCATCCCGACATCGGAATCTCTAGCAAGGCCATGGGAATCAT
                      ____________________________________________________________
consensus CAAGGTGCTGAAGCAGGTGCATCCCGACATCGGAATCTCTAGCAAGGCCATGGGAATCAT
 
. : . : . : . : . : . :
rJMFF022N07+ GAACAGTTTCATCAACGATATTTTCGAGAAGCTTGCCCAGGAGTCTTCTCGTCTTGCCCG
rJMSF046P16+ GAACAGTTTCATCAACGATATTTTCGAGAAGCTTGCCCAGGAGTCTTCTCGTCTTGCCCG
rJMSF037L11+ GAACAGTTTCATCAACGATATTTTCGAGAAGCTTGCCCAGGAGTCTTCTCGTCTTGCCCG
JMFN010I24- GAACAGTTTCATCAACGATATTTTCGAGAAGCTTGCCCAGGAGTCTTCTCGTCTTGCCCG
rJMFF007G20+ GAACAGTTTCATCAACGATATTTTCGAGAAGCTTGCCCAGGAGTCTTCTCGTCTTGCCCG
rJMFF033G19+ GAACAGTTTCATCAACGATATTTTCGAGAAGCTTGCCCAGGAGTCTTCTCGTCTTGCCCG
rJMFF008K09+ GAACAGTTTCATCAACGATATTTTCGAGAAGCTTGCCCAGGAGTCTTCTCGTCTTGCCCG
rJMFF036H08+ GAACAGTTTCATCAACGATATTTTCGAGAAGCTTGCCCAGGAGTCTTCTCGTCTTGCCCG
rJMSF019M08+ GAACAGTTTCATCAACGATATTTTCGAGAAGCTTGCCCAGGAGTCTTCTCGTCTTGCCCG
rJMSF019L08+ GAACAGTTTCATCAACGATATTTTCGAGAAGCTTGCCCAGGAGTCTTCTCGTCTTGCCCG
rJMSF010I22+ GAACAGTTTCATCAACGATATTTTCGAGAAGCTTGCCCAGGAGTCTTCTCGTCTTGCCCG
rJMSF017I24+ GAACAGTTTCATCAACGATATTTTCGAGAAGCTTGCCCAGGAGTCTTCTCGTCTTGCCCG
rJMSF022N03+ GAACAGTTTCATCAACGATATTTTCGAGAAGCTTGCCCAGGAGTCTTCTCGTCTTGCCCG
rJMSF019K02+ GAACAGTTTCATCAACGATATTTTCGAGAAGCTTGCCCAGGAGTCTTCTCGTCTTGCCCG
JMFF033G19- GAACAGTTTCATCAACGATATTTTCGAGAAGCTTGCCCAGGAGTCTTCTCGTCTTGCCCG
JMFF008K09- GAACAGTTTCATCAACGATATTTTCGAGAAGCTTGCCCAGGAGTCTTCTCGTCTTGCCCG
JMFF007G20- GAACAGTTTCATCAACGATATTTTCGAGAAGCTTGCCCAGGAGTCTTCTCGTCTTGCCCG
JMSF019M08- GAACAGTTTCATCAACGATATTTTCGAGAAGCTTGCCCAGGAGTCTTCTCGTCTTGCCCG
JMFF022N07- GAACAGTTTCATCAACGATATTTTCGAGAAGCTTGCCCAGGAGTCTTCTCGNCTTGCCCG
JMSF017I24- GAACAGTTTCATCAACGATATTTTCGAGAAGCTTGCCC
JMSF022N03- GAACAGTTTCATCAACGATATTTTCGAGAAGCTTGCCCAGGAGTCTTCTCGTCTTGCCCG
JMSF047H07- GAACAGTTTCATCAACGATATTTTCGAGAAGCTTGCCCAGGAGTCTTCTCGTCTTGCCCG
JMFF036H08- GAACAGTTTCATCAACGATATTTTCGAGAAGCTTGCCCAGGAGTCTTCTCGTCTTGCCCG
JMSF046P16- GAACAGTTTCATCAACGATATTTTCGAGAAGCTTGCCCAGGAGTCTTCTCGTCTTGCCCG
rJMSF041P02+ GAACAGTTTCATCAACGATATTTTCGAGAAGCTTGCCCAGGAGTCTTCTCGTCTTGCCCG
JMSF041P02- GAACAGTTTCATCAACGATATTTTCGAGAAGCTTGCCCAGGAGTCTTCTCGTCTTGCCCG
JMSF037L11- GAACAGTTTCATCAACGATATTTTCGAGAAGCTTGCCCAGGAGTCTTCTCGTCTTGCCCG
                      ____________________________________________________________
consensus GAACAGTTTCATCAACGATATTTTCGAGAAGCTTGCCCAGGAGTCTTCTCGTCTTGCCCG
 
. : . : . : . : . : . :
rJMFF022N07+ CTACAACAAGAAGCCCACCATCACCTCCCGCGAGATCCAGACCGCCGTCCGCTTGGTTCT
rJMSF046P16+ CTACAACAAGAAGCCCACCATCACCTCCCGCGAGATCCAGACCGCCGTCCGCTTGGTTCT
rJMSF037L11+ CTACAACAAGAAGCCCACCATCACCTCCCGCGAGATCCAGACCGCCGTCCGCTTGGTTCT
JMFN010I24- CTACAACAAGAAGCCCACCATCACCTCCCGCGAGATCCAGACCGCCGTCCGCTTGGTTCT
rJMFF007G20+ CTACAACAAGAAGCCCACCATCACCTCCCGCGAGATCCAGACCGCCGTCCGCTTGGTTCT
rJMFF033G19+ CTACAACAAGAAGCCCACCATCACCTCCCGCGAGATCCAGACCGCCGTCCGCTTGGTTCT
rJMFF008K09+ CTACAACAAGAAGCCCACCATCACCTCCCGCGAGATCCAGACCGCCGTCCGCTTGGTTCT
rJMFF036H08+ CTACAACAAGAAGCCCACCATCACCTCCCGCGAGATCCAGACCGCCGTCCGCTTGGTTCT
rJMSF019M08+ CTACAACAAGAAGCCCACCATCACCTCCCGCGAGATCCAGACCGCCGTCCGCTTGGTTCT
rJMSF019L08+ CTACAACAAGAAGCCCACCATCACCTCCCGCGAGATCCAGACCGCCGTCCGCTTGGTTCT
rJMSF010I22+ CTACAACAAGAAGCCCACCATCACCTCCCGCGAGATCCAGACCGCCGTCCGCTTGGTTCT
rJMSF017I24+ CTACAACAAGAAGCCCACCATCACCTCCCGCGAGATCCAGACCGCCGTCCGCTTGGTTCT
rJMSF022N03+ CTACAACAAGAAGCCCACCATCACCTCCCGCGAGATCCAGACCGCCGTCCGCTTGGTTCT
rJMSF019K02+ CTACAACAAGAAGCCCACCATCACCTCCCGCGAGATCCAGACCGCCGTCCGCTTGGTTCT
JMFF033G19- CTACAACAAGAAGCCCACCATCACCTCCCGCGAGATCCAGACCGCCGTCCGCTTGGTTCT
JMFF008K09- CTACAACAAGAAGCCCACCATCACCTCCCGCGAGATCCAGACCGCCGTCCGCTTGGTTCT
JMFF007G20- CTACAACAAGAAGCCCACCATCACCTCCCGCGAGATCCAGACCGCCGTCCGCTTGGTTCT
JMSF019M08- CTACAACAAGAAGCCCACCATCACCTCCCGCGAGATCCAGACCGCCGTCCGCTTGGTTCT
JMFF022N07- CTACAACAAGAAGCCCACCATCACCTCCCGCGAGAT
JMSF022N03- CTACAACAAGAAGCCCACCATCACCTCCCGCGAGATCCAGACCGCCGTCCGCTTGGTTCT
JMSF047H07- CTACAACAAGAAGCCCACCATCACCTCCCGCGAGATCCAGACCGCCGTCCGCTTGGTTCT
JMFF036H08- CTACAACAAGAAGCCCACCATCACCTCCCGCGAGATCCAGACCGCCGTCCGCTTGGTTCT
JMSF046P16- CTACAACAAGAAGCCCACCATCACCTCCCGCGAGATCCAGACCGCCGTCCGCTTGGTTCT
rJMSF041P02+ CTACAACAAGAAGCCCACCATCACCTCCCGCGAGATCCAGACCGCCGTCCGCTTGGTTCT
JMSF041P02- CTACAACAAGAAGCCCACCATCACCTCCCGCGAGATCCAGACCGCCGTCCGCTTGGTTCT
JMSF037L11- CTACAACAAGAAGCCCACCATCACCTCCCGCGAGATCCAGACCGCCGTCCGCTTGGTTCT
                      ____________________________________________________________
consensus CTACAACAAGAAGCCCACCATCACCTCCCGCGAGATCCAGACCGCCGTCCGCTTGGTTCT
 
. : . : . : . : . : . :
rJMFF022N07+ TCCCGGAGAATTGGCTAAGCACGCCGTCTCCGAAGGCACTAAGGCTGTCACCAAATTCAC
rJMSF046P16+ TCCCGGAGAATTGGCTAAGCACGCCGTCTCCGAAGGCACTAAGGCTGTCACCAAATTCAC
rJMSF037L11+ TCCCGGAGAATTGGCTAAGCACGCCGTCTCCGAAGGCACTAAGGCTGTCACCAAATTCAC
JMFN010I24- TCCCGGAGAATTGGCTAAGCACGCCGTCTCCGAAGGCACTAAGGCTGTCACCAAATTCAC
rJMFF007G20+ TCCCGGAGAATTGGCTAAGCACGCCGTCTCCGAAGGCACTAAGGCTGTCACCAAATTCAC
rJMFF033G19+ TCCCGGAGAATTGGCTAAGCACGCCGTCTCCGAAGGCACTAAGGCTGTCACCAAATTCAC
rJMFF008K09+ TCCCGGAGAATTGGCTAAGCACGCCGTCTCCGAAGGCACTAAGGCTGTCACCAAATTCAC
rJMFF036H08+ TCCCGGAGAATTGGCTAAGCACGCCGTCTCCGAAGGCACTAAGGCTGTCACCAAATTCAC
rJMSF019M08+ TCCCGGAGAATTGGCTAAGCACGCCGTCTCCGAAGGCACTAAGGCTGTCACCAAATTCAC
rJMSF019L08+ TCCCGGAGAATTGGCTAAGCACGCCGTCTCCGAAGGCACTAAGGCTGTCACCAAATTCAC
rJMSF010I22+ TCCCGGAGAATTGGCTAAGCACGCCGTCTCCGAAGGCACTAAGGCTGTCACCAAATTCAC
rJMSF017I24+ TCCCGGAGAATTGGCTAAGCACGCCGTCTCCGAAGGCACTAAGGCTGTCACCAAATTCAC
rJMSF022N03+ TCCCGGAGAATTGGCTAAGCACGCCGTCTCCGAAGGCACTAAGGCTGTCACCAAATTCAC
rJMSF019K02+ TCCCGGAGAATTGGCTAAGCACGCCGTCTCCGAAGGCACTAAGGCTGTCACCAAATTCAC
JMFF033G19- TCCCGGAGAATTGGCTAAGCACGCCGTCTCCGAAGGCACTAAGGCTGTCACCAAATTCAC
JMFF008K09- TCCCGGAGAATTGGCTAAGCACGCCGTCTCCGAAGGCACTAAGGCTGTCACCAAATTCAC
JMFF007G20- TCCCGGAGAATTGGCTAAGCACGCCGTCTCCGAAGGCACTAAGGCTGTCACCAAATTCAC
JMSF019M08- TCCCGGAGAATTGGCTAAGCACGCCGTCTCCGAA
JMSF022N03- TCCCGGAGAATTGGCTAAGCACGCCGTCTCCGAAGGCACTAAGGCTGTCACCAAATTCAC
JMSF047H07- TCCCGGAGAATTGGCTAAGCACGCCGTCTCCGAAGGCACTAAGGCTGTCACCAAATTCAC
JMFF036H08- TCCCGGAGAATTGGCTAAGCACGCCGTCTCCGAAGGCACTAAGGCTGTCACCAAATTCAC
JMSF046P16- TCCCGGAGAATTGGCTAAGCACGCCGTCTCCGAAGGCACTAAGGCTGTCACCAAATTCAC
rJMSF041P02+ TCCCGGAGAATTGGCTAAGCACGCCGTCTCCGAAGGCACTAAGGCTGTCACCAAATTCAC
JMSF041P02- TCCCGGAGAATTGGCTAAGCACGCCGTCTCCGAAGGCACTAAGGCTGTCACCAAATTCAC
JMSF037L11- TCCCGGAGAATTGGCTAAGCACGCCGTCTCCGAAGGCACTAAGGCTGTCACCAAATTCAC
                      ____________________________________________________________
consensus TCCCGGAGAATTGGCTAAGCACGCCGTCTCCGAAGGCACTAAGGCTGTCACCAAATTCAC
 
. : . : . : . : . : . :
rJMFF022N07+ TAGCTCGTAGAATGTTAGAGAATTTGCGTCTTTTATTTTTGCTATTCTAGGGTTTCATTT
rJMSF046P16+ TAGCTCGTAGAATGTTAGAGAATTTGCGTCTTTTATTTTTGCTATTCTAGGGTTTCATTT
rJMSF037L11+ TAGCTCGTAGAATGTTAGAGAATTTGCGTCTTTTATTTTTGCTATTCTAGGGTTTCATTT
JMFN010I24- TAGCTCGTAGAATGTTAGAGAATTTGCGTCTTTTATTTTTGCTATTCTAGGGTTTCATTT
rJMFF007G20+ TAGCTCGTAGAATGTTAGAGAATTTGCGTCTTTTATTTTTGCTATTCTAGGGTTTCATTT
rJMFF033G19+ TAGCTCGTAGAATGTTAGAGAATTTGCGTCTTTTATTTTTGCTATTCTAGGGTTTCATTT
rJMFF008K09+ TAGCTCGTAGAATGTTAGAGAATTTGCGTCTTTTATTTTTGCTATTCTAGGGTTTCATTT
rJMFF036H08+ TAGCTCGTAGAATGTTAGAGAATTTGCGTCTTTTATTTTTGCTATTCTAGGGTTTCATTT
rJMSF019M08+ TAGCTCGTAGAATGTTAGAGAATTTGCGTCTTTTATTTTTGCTATTCTAGGGTTTCATTT
rJMSF019L08+ TAGCTCGTAGAATGTTAGAGAATTTGCGTCTTTTATTTTTGCTATTCTAGGGTTTCATTT
rJMSF010I22+ TAGCTCGTAGAATGTTAGAGAATTTGCGTCTTTTATTTTTGCTATTCTAGGGTTTCATTT
rJMSF017I24+ TAGCTCGTAGAATGTTAGAGAATTTGCGTCTTTTATTTTTGCTATTCTAGGGTTTCATTT
rJMSF022N03+ TAGCTCGTAGAATGTTAGAGAATTTGCGTCTTTTATTTTTGCTATTCTAGGGTTTCATTT
rJMSF019K02+ TAGCTCGTAGAATGTTAGAGAATTTGCGTCTTTTATTTTTGCTATTCTAGGGTTTCATTT
JMFF033G19- TAGCTCGTAGAAT
JMFF008K09- TAGCTCGTAGA
JMFF007G20- TA
JMSF022N03- TAGCTCGTAGAATGTTAGAGAATTTGCGTCTTTTATTTTTGCTATTCTAGGGTTTCATTT
JMSF047H07- TAGCTCGTAGAATGTTAGAGAATTTGCGTCTTTTATTTTTGCTATTCTAGGGTTTCATTT
JMFF036H08- TAGCTCGTAGA
JMSF046P16- TAGCTCGTAGAATGTTAGAGAATTTGCGTCTTTTATTTTTGCTATTCTAGGGTTTCATTT
rJMSF041P02+ TAGCTCGTAGAATGTTAGAGAATTTGCGTCTTTTATTTTTGCTATTCTAGGGTTTCATTT
JMSF041P02- TAGCTCGTAGAATGTTAGAGAATTTGCGTCTTTTATTTTTGCTATTCTAGGGTTTCATTT
JMSF037L11- TAGCTCGTAGAATGTTAGAGAATTTGCGTCTTTTATTTTTGCTATTCTAGGGTTTCATTT
                      ____________________________________________________________
consensus TAGCTCGTAGAATGTTAGAGAATTTGCGTCTTTTATTTTTGCTATTCTAGGGTTTCATTT
 
. : . : . : . : . : . :
rJMFF022N07+ ACTGATTTACCTGTTATTGTTAGATGTAAAGTGGCTTCGGTTAGCTCGGATGGTCTGTTA
rJMSF046P16+ ACTGATTTACCTGTTATTGTTAGATGTAAAGTGGCTTCGGTTAGCTCGGATGGTCTGTTA
rJMSF037L11+ ACTGATTTACCTGTTATTGTTAGATGTAAAGTGGCTTCGGTTAGCTCGGATGGTCTGTTA
JMFN010I24- ACTGATTTACCTGTTATTGTTAGATGTAAAGTGGCTTCGGTTAGCTCGGATGGTCTGTTA
rJMFF007G20+ ACTGATTTACCTGTTATTGTTAGATGTAAAGTGGCTTCGGTTAGCTCGGATGGTCTGTTA
rJMFF033G19+ ACTGATTTACCTGTTATTGTTAGATGTAAAGTGGCTTCGGTTAGCTCGGATGGTCTGTTA
rJMFF008K09+ ACTGATTTACCTGTTATTGTTAGATGTAAAGTGGCTTCGGTTAGCTCGGATGGTCTGTTA
rJMFF036H08+ ACTGATTTACCTGTTATTGTTAGATGTAAAGTGGCTTCGGTTAGCTCGGATGGTCTGTTA
rJMSF019M08+ ACTGATTTACCTGTTATTGTTAGATGTAAAGTGGCTTCGGTTAGCTCGGATGGTCTGTTA
rJMSF019L08+ ACTGATTTACCTGTTATTGTTAGATGTAAAGTGGCTTCGGTTAGCTCGGATGGTCTGTTA
rJMSF010I22+ ACTGATTTACCTGTTATTGTTAGATGTAAAGTGGCTTCGGTTAGCTCGGATGGTCTGTTA
rJMSF017I24+ ACTGATTTACCTGTTATTGTTAGATGTAAAGTGGCTTCGGTTAGCTCGGATGGTCTGTTA
rJMSF022N03+ ACTGATTTACCTGTTATTGTTAGATGTAAAGTGGCTTCGGTTAGCTCGGATGGTCTGTTA
rJMSF019K02+ ACTGATTTACCTGTTATTGTTAGATGTAAAGTGGCTTCGGTTAGCTCGGATGGTCTG
JMSF022N03- ACTGATTTACCTGTTATTGTTAGATGTAAAGTGGCTTCGGTTAGCTCGGATGGTCTGTTA
JMSF047H07- ACTGATTTACCTGTTATTGTTAGATGTAAAGTGGCTTCGGTTAGCTCGGATGGTCTGTTA
JMSF046P16- ACTGATTTACCTGTTATTGTTAGATGTAAAGTGGCTTCGGTTAGCTCGGATGGTCTGTTA
rJMSF041P02+ ACTGATTTACCTGTTATTGTTAGATGTAAAGTGGCTTCGGTTAGCTCGTATGGTCTGTTA
JMSF041P02- ACTGATTTACCTGTTATTGTTAGATGTAAAGTGGCTTCGGTTAGCTCGTATGGTCTGTTA
JMSF037L11- ACTGATTTACCTGTTATTGTTAGATGTAAAGTGGCTTCGGTTAGCTCGGATGGTCTGTTA
                      ____________________________________________________________
consensus ACTGATTTACCTGTTATTGTTAGATGTAAAGTGGCTTCGGTTAGCTCGGATGGTCTGTTA
 
. : . : . : . : . : . :
rJMFF022N07+ TGCCAGTTGTAACGAACGTCTTATCAA
rJMSF046P16+ TGCCAGTTG
rJMSF037L11+ TGC
JMFN010I24- TGCCAGTTGTAACGAACGTCT
rJMFF007G20+ TGCCAGTTGTAACGAACGTCTTATCA
rJMFF033G19+ TGCCAGTTGTAACGAACGTCTTATCAA
rJMFF008K09+ TGCCAGTTGTAACGAACGTCTTATCAA
rJMFF036H08+ TGCCAGTTGTAACGAACGTCTTATCAA
rJMSF019M08+ TGCCAGTTG-AACGAACGTCT
rJMSF019L08+ TGCCAGTG--AACGAAC
rJMSF010I22+ TGCCAGTG
rJMSF017I24+ TGCCAGTG--AACGAAC
rJMSF022N03+ TGCCAGTG
JMSF022N03- TGCCAGTTGTAACGAACGTCTTATCAATGAATGAATGCTTT
JMSF047H07- TGCCAGTTGTAACGAACGTCTTATCAATGAATGAATGCTTTTATTTTTG
JMSF046P16- TGCCAGTTGTAACGAACGTCTTATCAATGAATGAATGCTTTTATTTTTGCAAAAAAAAAA
rJMSF041P02+ TGCCAGT
JMSF041P02- TGCCAGTTGTAACGAACGTCTTATCAATGAATGAATGCTTTTATTTTTGCAAAAAAAAAA
JMSF037L11- TGCCAGTTGTAACGAACGTCTTATCAATGAATGAATGCTTTTATTTTTGCAAAAAAAAAA
                      ____________________________________________________________
consensus TGCCAGTTGTAACGAACGTCTTATCAATGAATGAATGCTTTTATTTTTGCAAAAAAAAAA