Previous Contig 007167:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF028B20Sequence516007167 (5)gb:F21E10_16778051e-09Arabidopsis thaliana BAC F21E10, complete sequence.695003969 (6)gb:AY128278_15805807e-07Arabidopsis thaliana At5g26740 mRNA, complete cds.
JMFF041O07Sequence651007167 (5)gb:AC096687_17362213e-94Oryza sativa chromosome 3 BAC OSJNBa0010E04 genomic sequence, complete sequence.414003969 (6)gb:AC096687_17362213e-04Oryza sativa chromosome 3 BAC OSJNBa0010E04 genomic sequence, complete sequence.
JMFS057A02Sequence614007167 (5)gb:F21E10_16778059e-31Arabidopsis thaliana BAC F21E10, complete sequence.
JMFS095C10Sequence607007167 (5)gb:F21E10_16778059e-31Arabidopsis thaliana BAC F21E10, complete sequence.
JMSF037L06Sequence655007167 (5)gb:AY128278_15805803e-26Arabidopsis thaliana At5g26740 mRNA, complete cds.711003969 (6)gb:AY128278_15805803e-09Arabidopsis thaliana At5g26740 mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF041O07+ TAGCATAAACCGCTATAAGATCACTGAGAATAGTCCGTTTTGAG
                      ____________________________________________________________
consensus TAGCATAAACCGCTATAAGATCACTGAGAATAGTCCGTTTTGAG
 
. : . : . : . : . : . :
JMFF041O07+ GTTGCTGTGGTCGGTATTGCATATAGCTTGATCCCCTCAGCCAGCTTTTCCTCTTCATCA
                      ____________________________________________________________
consensus GTTGCTGTGGTCGGTATTGCATATAGCTTGATCCCCTCAGCCAGCTTTTCCTCTTCATCA
 
. : . : . : . : . : . :
JMFF041O07+ CCAACCAAGTCAATTGTCAGTGGATTGTTCAAATATTTCCTCGCTAGTTTCTTTACCCAG
                      ____________________________________________________________
consensus CCAACCAAGTCAATTGTCAGTGGATTGTTCAAATATTTCCTCGCTAGTTTCTTTACCCAG
 
. : . : . : . : . : . :
JMFF041O07+ CTAGGCATGGTTGCAGAAAATAGCATGCTCTGCCGCTGTGATGGAAGCTTTTCCAAGATT
                      ____________________________________________________________
consensus CTAGGCATGGTTGCAGAAAATAGCATGCTCTGCCGCTGTGATGGAAGCTTTTCCAAGATT
 
. : . : . : . : . : . :
JMFF041O07+ ACCTCCACATCCTCCTCAAACCCAACCGCAAGCATTTGATCAGCTTCATCAAGTACCAAA
                      ____________________________________________________________
consensus ACCTCCACATCCTCCTCAAACCCAACCGCAAGCATTTGATCAGCTTCATCAAGTACCAAA
 
. : . : . : . : . : . :
JMFF041O07+ TACTGAACTTCCCCCAGCTTCAGGCTATTATTGTTGATCAGGTCAATGAGTCTACCTGGA
                      ____________________________________________________________
consensus TACTGAACTTCCCCCAGCTTCAGGCTATTATTGTTGATCAGGTCAATGAGTCTACCTGGA
 
. : . : . : . : . : . :
JMFF041O07+ GTTCCAACAACCACGTCAACCCCACGGGAAAGTGCACTTTCCTGTGTAACATATGAGACT
                      ____________________________________________________________
consensus GTTCCAACAACCACGTCAACCCCACGGGAAAGTGCACTTTCCTGTGTAACATATGAGACT
 
. : . : . : . : . : . :
JMFF041O07+ CCTCCACATATACAGGCAGTGTTTAAGTGCGGCGCTGATTCTTTTATTTCTTTCTCTACT
                      ____________________________________________________________
consensus CCTCCACATATACAGGCAGTGTTTAAGTGCGGCGCTGATTCTTTTATTTCTTTCTCTACT
 
. : . : . : . : . : . :
JMFF041O07+ TGTTTGGCTAACTCTCTAGTAGGTGCAAGGACCAAAACTCGAGGCAGTCGTCCCCGCCTT
                      ____________________________________________________________
consensus TGTTTGGCTAACTCTCTAGTAGGTGCAAGGACCAAAACTCGAGGCAGTCGTCCCCGCCTT
 
. : . : . : . : . : . :
JMFF041O07+ TGAGAAAATTTTGACTGTTCATCTTCAGTAATCCTTTTAATTATTGGGATACCAAATGCA
JMFS095C10+ ACTGTTCATCTTCAGTAATCCTTTTAATTATTGGGATACCAAATGCA
JMFS057A02+ ACTGTTCATCTTCAGTAATCCTTTTAATTATTGGGATACCAAATGCA
JMSF037L06+ AAAATTTTGACTGTTCATCTTCAGTAATCCTTTTAATTATTGGGATACCAAATGCA
                      ____________________________________________________________
consensus TGAGAAAATTTTGACTGTTCATCTTCAGTAATCCTTTTAATTATTGGGATACCAAATGCA
 
. : . : . : . : . : . :
JMFF041O07+ AGTGTCTTCCCTGTCCCAGTTTTTGCTCTAGCAATTATATCGCGACCTTCCAATGCAGGT
JMFS095C10+ AGTGTCTTCCCTGTCCCAGTTTTTGCTCTAGCAATTATATCGCGACCTTCCAATGCAGGT
JMFS057A02+ AGTGTCTTCCCTGTCCCAGTTTTTGCTCTAGCAATTATATCGCGACCTTCCAATGCAGGT
JMSF037L06+ AGTGTCTTCCCTGTCCCAGTTTTTGCTCTAGCAATTATATCGCGACCTTCCAATGCAGGT
                      ____________________________________________________________
consensus AGTGTCTTCCCTGTCCCAGTTTTTGCTCTAGCAATTATATCGCGACCTTCCAATGCAGGT
 
. : . : . : . : . : . :
JMFF041O07+ ATCAATA
JMFS095C10+ ATCAATACAGCTCTCTGAATTGGGAAAAGATTGGTAATCCCTCGTTTCTCAAGAGTCTCA
JMFS057A02+ ATCAATACAGCTCTCTGAATTGGGAAAAGATTGGTAATCCCTCGTTTCTCAAGAGTCTCA
JMFF028B20+ TTGGGAAAAGATTGGTAATCCCTCGTTTCTCAAGAGTCTCA
JMSF037L06+ ATCAATACAGCTCTCTGAATTGGGAAAAGATTGGTAATCCCTCG-TTCTCAAGAGTCTCA
                      ____________________________________________________________
consensus ATCAATACAGCTCTCTGAATTGGGAAAAGATTGGTAATCCCTCGTTTCTCAAGAGTCTCA
 
. : . : . : . : . : . :
JMFS095C10+ ACTAACTGCCGAGGCAAACCTAGTTTGGAAACTGCAAGTTCATCGTCACTATCAGCCGCT
JMFS057A02+ ACTAACTGCCGAGGCAAACCTAGTTTGGAAACTGCAAGTTCATCGTCACTATCAGCCGCT
JMFF028B20+ ACTAACTGCCGAGGCAAACCTAGTTTGGAAACTGCAAGTTCATCGTCACTATCAGCCGCT
JMSF037L06+ ACTAACTGCCGAGGCAAACCTAGTTTGGAAACTGCAAGTTCATCGTCACTATCAGCCGCT
                      ____________________________________________________________
consensus ACTAACTGCCGAGGCAAACCTAGTTTGGAAACTGCAAGTTCATCGTCACTATCAGCCGCT
 
. : . : . : . : . : . :
JMFS095C10+ CCGAGCTCGCTCTCATCCTCATCGAGCTCCGAATCATACTCAGCGTCGCTGACATCCAAG
JMFS057A02+ CCGAGCTCGCTCTCATCCTCATCGAGCTCCGAATCATACTCAGCGTCGCTGACATCCAAG
JMFF028B20+ CCGAGCTCGCTCTCATCCTCATCGAGCTCCGAATCATACTCAGCGTCGCTGACATCCAAG
JMSF037L06+ CCGAGCTCGCTCTCATCCTCATCGAGCTCCGAATCATACTCAGCGTCGCTGACATCCAAG
                      ____________________________________________________________
consensus CCGAGCTCGCTCTCATCCTCATCGAGCTCCGAATCATACTCAGCGTCGCTGACATCCAAG
 
. : . : . : . : . : . :
JMFS095C10+ GAATCCTTGGCGAACCCGCCGAGCCCCTTGAAGGCCTCCTCGCTGAGCAGAGAAGAATTG
JMFS057A02+ GAATCCTTGGCGAACCCGCCGAGCCCCTTGAAGGCCTCCTCGCTGAGCAGAGAAGAATTG
JMFF028B20+ GAATCCTTGGCGAACCCGCCGAGCCCCTTGAAGGCCTCCTCGCTGAGCAGAGAAGAATTG
JMSF037L06+ GAATCCTTGGCGAACCCGCCGAGCCCCTTGAAGGCCTCCTCGCTGAGCAGAGAAGAATTG
                      ____________________________________________________________
consensus GAATCCTTGGCGAACCCGCCGAGCCCCTTGAAGGCCTCCTCGCTGAGCAGAGAAGAATTG
 
. : . : . : . : . : . :
JMFS095C10+ GGAGTGACCACAGCCGAAGCAACAAACGGGCTCGAACTCGAGCACTGCTTTGAACGAACA
JMFS057A02+ GGAGTGACCACAGCCGAAGCAACAAACGGGCTCGAACTCGAGCACTGCTTTGAACGAACA
JMFF028B20+ GGAGTGACCACAGCCGAAGCAACAAACGGGCTCGAACTCGAGCACTGCTTTGAACGAACA
JMSF037L06+ GGAGTGACCACAGCCGAAGCAACAAACGGGCTCGAACTCGAGCACTGCTTTGAACGAACA
                      ____________________________________________________________
consensus GGAGTGACCACAGCCGAAGCAACAAACGGGCTCGAACTCGAGCACTGCTTTGAACGAACA
 
. : . : . : . : . : . :
JMFS095C10+ AGCGACGATGAAGAAAAAGCTTTTAGGGGATTGAAATGAAGCTTCTCAAAGGATTGAGGG
JMFS057A02+ AGCGACGATGAAGAAAAAGCTTTTAGGGGATTGAAATGAAGCTTCTCAAAGGATTGAGGG
JMFF028B20+ AGCGACGATGAAGAAAAAGCTTTTAGGGGATTGAAATGAAGCTTCTCAAAGGATTGAGGG
JMSF037L06+ AGCGACGATGAAGAAAAAGCTTTTAGGGGATTGAAATGAAGCTTCTCAAAGGATTGAGGG
                      ____________________________________________________________
consensus AGCGACGATGAAGAAAAAGCTTTTAGGGGATTGAAATGAAGCTTCTCAAAGGATTGAGGG
 
. : . : . : . : . : . :
JMFS095C10+ AAAGATAGAGGAGGAGTAGAAGTAGGCCTCTTGGAATGTTCTAGAGACGGGTTAGCTTGG
JMFS057A02+ AAAGATAGAGGAGGAGTAGAAGTAGGCCTCTTGGAATGTTCTAGAGACGGGTTAGCTTGG
JMFF028B20+ AAAGATAGAGGAGGAGTAGAAGTAGGCCTCTTGGAATGTTCTAGAGACGGGTTAGCTTGG
JMSF037L06+ AAAGATAGAGGAGGAGTAGAAGTAGGCCTCTTGGAATGTTCTAGAGACGGGTTAGCTTGG
                      ____________________________________________________________
consensus AAAGATAGAGGAGGAGTAGAAGTAGGCCTCTTGGAATGTTCTAGAGACGGGTTAGCTTGG
 
. : . : . : . : . : . :
JMFS095C10+ AATATGGAGGAAACACCGATAATGGAGGAAGTATATGCCATGGCCTCAGAGAAGAAGAAG
JMFS057A02+ AATATGGAGGAAACACCGATAATGGAGGAAGTATATGCCATGGCCTCAGAGAAGAAGAAG
JMFF028B20+ AATATGGAGGAAACACCGATAATGGAGGAAGTATATGCCATGGCCTCAGAGAAGAAGAAG
JMSF037L06+ AATATGGAGGAAACACCGATAATGGAGGAAGTATATGCCATGGCCTCAGAGAAGAAGAAG
                      ____________________________________________________________
consensus AATATGGAGGAAACACCGATAATGGAGGAAGTATATGCCATGGCCTCAGAGAAGAAGAAG
 
. : . : . : . : . : . :
JMFS095C10+ AAGAAGAAGAAGAAGAAGGG
JMFS057A02+ AAGAAGAAGAAGAAGAAGGG
JMFF028B20+ AAGAAGAAGAAGAAGAAGGGGATAAGGGTGCGGTTGTATGGGGTTTAAGGAAAGT
JMSF037L06+ AAGAAGAAGAAGAAGAAGGGGATAAGGGTGCGGTTGTATGGGGTTTAAGGGAAGTGAATC
                      ____________________________________________________________
consensus AAGAAGAAGAAGAAGAAGGGGATAAGGGTGCGGTTGTATGGGGTTTAAGGGAAGTGAATC