Previous Contig 007166:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF037K16Sequence693007166 (2)pir|T10240|T102403e-73hypothetical protein T11I11.180 - Arabidopsis thaliana>gb:ATCHRIV82_1547455 Arab708013115 (2)gb:AP006067_18608431e-46Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, PAC clone:P056
JMSF046H07Sequence777007166 (2)pir|T10240|T102405e-85hypothetical protein T11I11.180 - Arabidopsis thaliana>gb:ATCHRIV82_1547455 Arab769013115 (2)gb:AB011474_15113643e-51Arabidopsis thaliana genomic DNA, chromosome 5, TAC clone:K2A18.>gb:AY136368_158

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF046H07+ ACTTGGCAGACGCCGGCGTGGAGCATTTGTTCGACGGTTTCGGGGTCGCGG
                      ____________________________________________________________
consensus ACTTGGCAGACGCCGGCGTGGAGCATTTGTTCGACGGTTTCGGGGTCGCGG
 
. : . : . : . : . : . :
JMSF046H07+ CCGAGCAATCCGATTGCTCTGGCGGCGTTTTCCTGGCCTTCTGGTTTGCCGTCCTTGAGG
                      ____________________________________________________________
consensus CCGAGCAATCCGATTGCTCTGGCGGCGTTTTCCTGGCCTTCTGGTTTGCCGTCCTTGAGG
 
. : . : . : . : . : . :
JMSF046H07+ AGTTTGAGCAATGGCGGGACTCCGCCTTCCTCGATGATTAGCTTCCCGTAGCGATCATTG
JMSF037K16+ TCCTCGATGATTAGCTTCCCGTAGCGATCATTG
                      ____________________________________________________________
consensus AGTTTGAGCAATGGCGGGACTCCGCCTTCCTCGATGATTAGCTTCCCGTAGCGATCATTG
 
. : . : . : . : . : . :
JMSF046H07+ TCCCTGGCCAGGGAAACCAGGGAGGCGGCGGCGTCGGAGCGGTCGTCGAGGGATCCGGTG
JMSF037K16+ TCCCTGGCCAGGGAAACCAGGGAGGCGGCGGCGTCGGAGCGGTCGTCGAGGGATCCGGTG
                      ____________________________________________________________
consensus TCCCTGGCCAGGGAAACCAGGGAGGCGGCGGCGTCGGAGCGGTCGTCGAGGGATCCGGTG
 
. : . : . : . : . : . :
JMSF046H07+ TAGAGAATCGCAATCTGTTCCCATATGAGGCAGAGGATGGGCTCGTTGGCGGCGATCGGC
JMSF037K16+ TAGAGAATCGCAATCTGTTCCCATATGAGGCAGAGGATGGGCTCGTTGGCGGCGATCGGC
                      ____________________________________________________________
consensus TAGAGAATCGCAATCTGTTCCCATATGAGGCAGAGGATGGGCTCGTTGGCGGCGATCGGC
 
. : . : . : . : . : . :
JMSF046H07+ GGGAGGCCGAGGTACTCGTCGTCGCGTGCGTCGGCGGAGGCGGAGACGCGGAGGAGCCAC
JMSF037K16+ GGGAGGCCGAGGTACTCGTCGTCACGTGCGTCGGCGGAGGCGGAGACGCGGAGGAGCCAC
                      ____________________________________________________________
consensus GGGAGGCCGAGGTACTCGTCGTCGCGTGCGTCGGCGGAGGCGGAGACGCGGAGGAGCCAC
 
. : . : . : . : . : . :
JMSF046H07+ GACACATCCCCGATCGAGTTATCCAGCTGGGATTGCATCTTCCGGAACGCCGCCGCGGGA
JMSF037K16+ GACACATCCCCGATCGAGTTATCCAGCTGGGATTGCATCTTCCGGAACGCCGCCGCGGGA
                      ____________________________________________________________
consensus GACACATCCCCGATCGAGTTATCCAGCTGGGATTGCATCTTCCGGAACGCCGCCGCGGGA
 
. : . : . : . : . : . :
JMSF046H07+ ACGATGGTGAACACGCGCTTCACCAGCCCGTGCGTGCGGCACTTCACCACCAACACTAAC
JMSF037K16+ ACGATGGTGAACACGCGCTTCACCAGCCCGTGCGTGCGGCACTTCACCACCAACACTAAC
                      ____________________________________________________________
consensus ACGATGGTGAACACGCGCTTCACCAGCCCGTGCGTGCGGCACTTCACCACCAACACTAAC
 
. : . : . : . : . : . :
JMSF046H07+ GCCTTCTCCAGAACCTGCTCCGTGTCCTCCACGATCCGCCGCGTCGGCCGCTCGTACAGG
JMSF037K16+ GCCTTCTCCAGAACCTGCTCCGTGTCCTCCACGATCCGCCGCGTCGGCCGCTCGTACAGG
                      ____________________________________________________________
consensus GCCTTCTCCAGAACCTGCTCCGTGTCCTCCACGATCCGCCGCGTCGGCCGCTCGTACAGG
 
. : . : . : . : . : . :
JMSF046H07+ TCGTTGCTGGCACGCGCCGCCTGCCGCAGCAGCGCCGCCAGCTTCTCCGTCTTCGTCTTC
JMSF037K16+ TCGTTGCTGGCACGCGCCGCCTGCCGCAGCAGCGCCGCCAGCTTCTCCGTCTTCGTCTTC
                      ____________________________________________________________
consensus TCGTTGCTGGCACGCGCCGCCTGCCGCAGCAGCGCCGCCAGCTTCTCCGTCTTCGTCTTC
 
. : . : . : . : . : . :
JMSF046H07+ AACTCCGCGCATTCCTGCTTGAACGAATAGCTAGCCTCGTCCGCCGCCTTAGTCACCTGG
JMSF037K16+ AACTCCGCGCATTCCTGCTTGAACGAATAGCTAGCCTCGTCCGCCGCCTTAGTCACCTGG
                      ____________________________________________________________
consensus AACTCCGCGCATTCCTGCTTGAACGAATAGCTAGCCTCGTCCGCCGCCTTAGTCACCTGG
 
. : . : . : . : . : . :
JMSF046H07+ TCCGCCAATTGAATCGGCTTCGCAAGGATCTGCTTCACTTTATCCGCCATTAAAGCTACG
JMSF037K16+ TCCGCCAATTGAATCGGCTTCGCAAGGATCTGCTTCACTTTATCCGCCATTAAAGCTACG
                      ____________________________________________________________
consensus TCCGCCAATTGAATCGGCTTCGCAAGGATCTGCTTCACTTTATCCGCCATTAAAGCTACG
 
. : . : . : . : . : . :
JMSF046H07+ ATTATCTGTGAAAATTAAAATGCTTGAAGAAAGCAAGGTAGAAAACTGGGAAATGGATCT
JMSF037K16+ ATTATCTGTGAAAATTAAAATGCTTGAAGAAAGCAAGGTAGAAAACTGGGAAATGGATCT
                      ____________________________________________________________
consensus ATTATCTGTGAAAATTAAAATGCTTGAAGAAAGCAAGGTAGAAAACTGGGAAATGGATCT
 
. : . : . : . : . : . :
JMSF046H07+ ACATT
JMSF037K16+ ACATTGATAATAAGCTAAAGGAAGGTCGTCAATGGAGGTCGTCGGGGACAAGGTCAAACC
                      ____________________________________________________________
consensus ACATTGATAATAAGCTAAAGGAAGGTCGTCAATGGAGGTCGTCGGGGACAAGGTCAAACC